Mathematics, 01.08.2019 17:40 JSTAX01

Solve the following system of equations by using the substitution method. y = -3x + 5 5x – 4y = -3 (-1, -2) (2, 1) (3, 4) (1, 2)

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 16:00

Will give brainliest what is the value of x? enter your answer in the box.

Answers: 1

Answer

Mathematics, 21.06.2019 17:30

Adriver from the university of florida women’s swimming and diving team is competing in the in ncaa zone b championships

Answers: 3

Answer

Mathematics, 21.06.2019 18:00

Express in the simplest form: (x^2+9x+14/x^2-49) / (3x+6/x^2+x-56)

Answers: 3

Answer

Mathematics, 21.06.2019 20:30

Linda loans her friend $250 with a 5% monthly intrest rate. how much was the whole loan?

Answers: 1

Answer

You know the right answer?

Solve the following system of equations by using the substitution method. y = -3x + 5 5x – 4y = -3 (...

Questions

Mathematics, 01.04.2021 17:30

Jawan made a table to figure out how much he earns at his job (image below)

Mathematics, 01.04.2021 17:30

Geometry Questions s ...

Business, 01.04.2021 17:30

On December 31, 2015, Nolte Co. is in financial difficulty and cannot pay a note due that day. It is a $3,000,000 note with $300,000 accrued interest...

Biology, 01.04.2021 17:30

Many mammals whose diet includes a great deal of leafy plant matter have extra compartments or extensions of their digestive tract that are not presen...

Mathematics, 01.04.2021 17:30

ANSWER QUICK PLS Find m4 if m1 = 100°. a. 100° b. 80° c. 180° d. 90°

English, 01.04.2021 17:30

can some one help me with this not all the answers fit in this one so i'll post as many as i can and post the restin another one.

History, 01.04.2021 17:30

At the "first Thanksgiving," the Pilgrims famously feasted with the American Indians. Think about what you learned about Pilgrims, Puritans, and Ameri...

English, 01.04.2021 17:30

Which sentence best explains Lincoln's wartime decisions? BRANLIEST adapted from Lincoln the Great by Wilfred W. McClay We should r...

English, 01.04.2021 17:30

What Is the parallel structure and how do I find it?...

Business, 01.04.2021 17:30

The manufacturing overhead budget at Foshay Corporation is based on budgeted direct labor-hours. The direct labor budget indicates that 7,800 direct l...

English, 01.04.2021 17:30

For a company to develop an effective customer-centric culture, there is always room for:...

Mathematics, 01.04.2021 17:30

This math problem help me...

Biology, 01.04.2021 17:30

What is the complimentary strand for the DNA AACGGTCCAGTCCAAGTTACG?...

Chemistry, 01.04.2021 17:30

Which of the following statements are true regarding the remainder of the experiment if the scientist wants to use the combined gas law to calculate d...

Biology, 01.04.2021 17:30

Which scenario MOST LIKELY represents genetic drift and why? Question 2 options: Scenario 2, because the dark beetles are most fit for th...

Mathematics, 01.04.2021 17:30

Please help Lia brought 21 shirts and plants. Her total was $357. Pants cost $25 each, and shirts cost $14.50 each. How many of each item did she buy?...

Business, 01.04.2021 17:30

The McAllisters had several serious problems with their house, including leaks in the ceiling, a buckling wall, and dampness. They repaired the buckli...

Business, 01.04.2021 17:30

The goal of the review in a business presentation is to Multiple choice question. compel audience members to consider taking specific actions. lead au...

History, 01.04.2021 17:30

"If a thousand [citizens] were not to pay their tax-bills this year, that would not be a violent and bloody measure, as it would be to pay them, and e...

History, 01.04.2021 17:30

Which TWO of the following is a task carried out by the executive branch? Select two answers....

More questions: Mathematics Another questions