What is the complimentary strand for the DNA AACGGTCCAGTCCAAGTTACG?

Read the sentence. “yesterday we arrived late for the outdoor concert in the city gardens.” which words in the sentence are adverbs? a. late; city b. yesterday; outdoor c. yesterday; late d. outdoor; city

Waianapanapa beach in hawaii is a black-sand beach that was formed by waves crashing against volcanic rock. the sand can be very hot on sunny days. which statement best explains why? o a. the black sand has no heat capacity. b. the black sand absorbs no radiation. o c. the black sand is immune to insolation. d. the black sand has a low albedo.

Pls ! in your opinion, what are the limiting factors that might affect the growth or diversity of our ecosystem? respond to this question in claim, evidence, reasoning format. 1. make your claim (i are the limiting factors that might affect the growth or diversity of our 2. follow the claim with 3 pieces of evidence. evidence may be taken from the reading, the videos, previous lessons, or googled answers. site sources, too. 3. use reasoning to explain why you chose your evidence.