Mathematics, 19.02.2022 17:10 lizzyhearts

I need help with this question

Answers: 2

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 19:20

Will give brainliest immeadeately true or false: the origin woud be included in the solution set for the inequality: y< 2x-5

Answers: 1

Answer

Mathematics, 21.06.2019 19:50

If the scale factor between two circles is 2x/5y what is the ratio of their areas?

Answers: 3

Answer

Mathematics, 21.06.2019 22:00

If abcde is reflected over the x-axis and then translated 3 units left, what are the new coordinates d? are he re

Answers: 1

Answer

Mathematics, 21.06.2019 22:30

Shannon drove for 540 minutes. if she traveled 65 miles per hour,how many total miles did she travel?

Answers: 2

Answer

You know the right answer?

I need help with this question
...

Questions

Mathematics, 04.04.2020 13:59

An isocost line Question 7 options: 1) represents the combinations of w and K that cost the firm the same amount of money. 2) represents the combinati...

Mathematics, 04.04.2020 13:59

Thirty-six of the staff of 80 teachers at a local intermediate school are certified in Cardio-Pulmonary Resuscitation (CPR). In 180 days of school, ab...

Mathematics, 04.04.2020 13:59

PLEASE HELP I WILL MARK BRAINLIEST...

Mathematics, 04.04.2020 13:59

PLEASE!! Dinah invests $850 in a high-yield savings account. The account pays 3% simple interest annually. Is it reasonable that Dinah wil...

Biology, 04.04.2020 13:59

Which steps are part of the process during the formation of molded fossils? Check all that apply. Sediment hardens into rock. Sedime...

Mathematics, 04.04.2020 13:59

PLEASE HELP WILL NAME BRAINLIEST...

Computers and Technology, 04.04.2020 14:00

Which of the following is true of data collection:. a. Data collection is of secondary importance to computer security. b. Data collection should not...

Physics, 04.04.2020 14:00

An air-plane has an effective wing surface area of 17.0 m² that is generating the lift force. In level flight the air speed over the top of the wings...

Biology, 04.04.2020 14:00

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along thi...

Chemistry, 04.04.2020 14:00

2.00 moles of an ideal gas was found to occupy a volume of 17.4L at a pressure of 3.00 atm and at a temperature of 45 C. Calulate the value of the cas...

Mathematics, 04.04.2020 14:00

A group of n people enter an elevator in a building with k floors. Each person independently selects a floor uniformly at random (each with equal prob...

Chemistry, 04.04.2020 14:01

What is likely to be true about the ∆H for this reaction? C6H6 (l) → C6H6 (s) ∆H>0 ∆H=0 ∆H<0...

Mathematics, 04.04.2020 14:01

Cole is studying employment trends.He found that 20% of the social workers he surveyed, or 45 social workers,work part time. How many soci...

Business, 04.04.2020 14:01

A 12-year bond of a firm in severe financial distress has a coupon rate of 12% and sells for $920. The firm is currently renegotiating the debt, and i...

Business, 04.04.2020 14:01

Magic Milling Company has 9% annual coupon bonds that are callable and have 18 years left until maturity. The bonds have a par value of $1,000, and th...

Mathematics, 04.04.2020 14:01

He assignment problem is . ANSWER Unselected a specialized form of an optimization model that attempts to assign limited capacity to various demand po...

Mathematics, 04.04.2020 14:01

Ashley picked up 15 rocks. 3 igneous, 3 metamorphic, and 9 sedimentary. What is the ratio of sedimentary rocks to the total number of rocks?...

Mathematics, 04.04.2020 14:01

Consider quadrilateral BCEF inscribed in circle A. Diagonals EB and CF intersect at point D. Select all the statements that are true about the diagram...

Business, 04.04.2020 14:01

Bay City uses the purchases method to account for supplies. At the beginning of the year the city had no supplies on hand. During the year the city pu...

Computers and Technology, 04.04.2020 14:01

All but one of the following statements about stored procedures is true. Which one is false? a. They consist of one or more SQL statements. b. They ar...

More questions: Mathematics Another questions