Biology, 04.04.2020 14:00 devo1459

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.

Answers: 1

Show answers

Another question on Biology

Biology, 22.06.2019 00:00

Sea stars, sea urchins, sand dollars, and brittle stars are all memeber of a group, what is the common name of the group they are all in

Answers: 1

Answer

Biology, 22.06.2019 10:40

Describe characteristics of a good respitory surface

Answers: 1

Answer

Biology, 22.06.2019 14:30

Which describes the changes in the earths motion?

Answers: 3

Answer

Biology, 22.06.2019 15:30

Modern computers can store about as much information as the human brain. true false its false i took the test

Answers: 2

Answer

You know the right answer?

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCG...

Questions

Physics, 25.07.2021 17:10

Two charges 3*10^-5 C and 5*10^4 C are placed at a distance 10 cm form each other. Find the value of electrostatic force acting between them. a) 13.5...

Computers and Technology, 25.07.2021 17:10

cises t Answer Questions 1. What is Open source Operating System? Write the advantages and disadvantages of Open source Operating System....

Social Studies, 25.07.2021 17:10

What would happen if there were no rules for you school? I...

Mathematics, 25.07.2021 17:10

b) Cho tam giác đều ABC có tâm G, tìm ảnh của điểm B và ảnh của tam giác GCA qua phép quay tâm G góc quay -90 độ...

Social Studies, 25.07.2021 17:10

Suggest a measure to increase the number of skilled human resources...

Chemistry, 25.07.2021 17:10

Consider two gases, A and B, which are in a container at room temperature. What effect will the following changes have on the rate of the reaction bet...

Social Studies, 25.07.2021 17:10

Any girl interested in love with me...

World Languages, 25.07.2021 17:10

Which of the following is used as a solidifying agent for media...

Mathematics, 25.07.2021 17:10

On a piece of paper, graph y= see pic ...

Mathematics, 25.07.2021 17:10

(ITS JUST ADDING) super star is 75 4x, werewolf hat 175, kitty glasses 25, 65 mask ‘face mask’ 35 crybaby, 350 character, x2 85,75 silky red,90x red h...

Physics, 25.07.2021 17:10

A 65.0 kg skier with an initial speed of 13.0 m/s coasts up a 2.50 m high rise as shown in Figure 6.23. Find his final speed at the top, given that th...

Physics, 25.07.2021 17:10

b. The stream of water flowing through a hole at depth h = 10 cm in a tank holding water to height H = 40 cm. . 3 At what distance x does the stream s...

Physics, 25.07.2021 17:10

A person in good physical condition can put out 100 W of useful power for several hours at a stretch, perhaps by pedaling a mechanism that drives an e...

Chemistry, 25.07.2021 17:10

Calculate concentration of salt, pH and pka of NH4CI, percent degree of hydrolysis 0.0232%...

Mathematics, 25.07.2021 17:10

Express 4.9 (bar only on 9)in the form of p/q...

English, 25.07.2021 17:10

How / much / cost / send / a box / cherries / the US?...

Physics, 25.07.2021 17:10

A metallic sphere has a charge of +4.0 nC. A negatively charged rod has a charge of -6.0 nC. When the rod touches the sphere, 8.2 x 109 electrons are...

English, 25.07.2021 17:10

Sister / secretary / and / work / company / suburb / capital....

Social Studies, 25.07.2021 17:10

What do you know about the formulation of the present constitution of Nepal?...

Biology, 25.07.2021 17:10

If any girl wants to be my gírlfriend then please comment me....

More questions: Biology Another questions