subject

Mathematics, 19.04.2021 20:30 bheam12

Answer this for brainiest (easy)

Answer this for brainiest (easy)

ansver

Answers: 3

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 15:40

The transitive property of equality states that: o if a = b, then bra o if a = b, then ac = bc o if a = b and b= c, then a = if a = b and c= c, then a + b = b + c

Answers: 2

question

Mathematics, 21.06.2019 20:00

The two square pyramids are similar. find the total volume of both pyramids if the ratio of their surface areas is 9/16

Answers: 3

question

Mathematics, 21.06.2019 20:00

Parabolas y=−2x^2 and y=2x^2 +k intersect at points a and b that are in the third and the fourth quadrants respectively. find k if length of the segment ab is 5.

Answers: 1

question

Mathematics, 21.06.2019 20:30

Wrote and expression for the difference of p and 4

Answers: 1

You know the right answer?

Answer this for brainiest (easy)
...

Questions

question

Business, 01.04.2021 17:30

On December 31, 2015, Nolte Co. is in financial difficulty and cannot pay a note due that day. It is a $3,000,000 note with $300,000 accrued interest...

question

Biology, 01.04.2021 17:30

Many mammals whose diet includes a great deal of leafy plant matter have extra compartments or extensions of their digestive tract that are not presen...

question

Mathematics, 01.04.2021 17:30

ANSWER QUICK PLS Find m4 if m1 = 100°. a. 100° b. 80° c. 180° d. 90°

question

English, 01.04.2021 17:30

can some one help me with this not all the answers fit in this one so i'll post as many as i can and post the restin another one.

question

History, 01.04.2021 17:30

At the "first Thanksgiving," the Pilgrims famously feasted with the American Indians. Think about what you learned about Pilgrims, Puritans, and Ameri...

question

English, 01.04.2021 17:30

Which sentence best explains Lincoln's wartime decisions? BRANLIEST adapted from Lincoln the Great by Wilfred W. McClay We should r...

question

English, 01.04.2021 17:30

What Is the parallel structure and how do I find it?...

question

Business, 01.04.2021 17:30

The manufacturing overhead budget at Foshay Corporation is based on budgeted direct labor-hours. The direct labor budget indicates that 7,800 direct l...

question

English, 01.04.2021 17:30

For a company to develop an effective customer-centric culture, there is always room for:...

question

Mathematics, 01.04.2021 17:30

This math problem help me...

question

Biology, 01.04.2021 17:30

What is the complimentary strand for the DNA AACGGTCCAGTCCAAGTTACG?...

question

Chemistry, 01.04.2021 17:30

Which of the following statements are true regarding the remainder of the experiment if the scientist wants to use the combined gas law to calculate d...

question

Biology, 01.04.2021 17:30

Which scenario MOST LIKELY represents genetic drift and why? Question 2 options: Scenario 2, because the dark beetles are most fit for th...

question

Mathematics, 01.04.2021 17:30

Please help Lia brought 21 shirts and plants. Her total was $357. Pants cost $25 each, and shirts cost $14.50 each. How many of each item did she buy?...

question

Business, 01.04.2021 17:30

The McAllisters had several serious problems with their house, including leaks in the ceiling, a buckling wall, and dampness. They repaired the buckli...

question

Business, 01.04.2021 17:30

The goal of the review in a business presentation is to Multiple choice question. compel audience members to consider taking specific actions. lead au...

question

History, 01.04.2021 17:30

"If a thousand [citizens] were not to pay their tax-bills this year, that would not be a violent and bloody measure, as it would be to pay them, and e...

question

History, 01.04.2021 17:30

Which TWO of the following is a task carried out by the executive branch? Select two answers....

question

Mathematics, 01.04.2021 17:30

Solve for x please help ...

question

History, 01.04.2021 17:30

Do you think something like the Red Scare could happen again?...

More questions: Mathematics Another questions

Questions on the website: 13722360