Mathematics, 01.03.2021 07:40 angelica3752

Pls answer the university is on a bearing of 050° from the stadium and 300° from the hospital

mark the position of the university on the map with a cross (x)

Pls answer

the university is on a bearing of 050° from the stadium and 300° from the hospital
ma

Answers: 2

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 17:30

Solve: 3x+y=6 4x-2y=18 show all work !

Answers: 1

Answer

Mathematics, 21.06.2019 17:40

If sec theta = 5/3 and the terminal point determined by theta is in quadrant 4, then

Answers: 1

Answer

Mathematics, 21.06.2019 20:00

Mat bought a phone for $100. he has to pay $30 per mouth. if he has paid $640 in total, how many mouth has he had the phone?

Answers: 2

Answer

Mathematics, 22.06.2019 00:30

Nellie is analyzing a quadratic function f(x) and a linear function g(x). will they intersect? f(x) g(x) graph of the function f of x equals one half times x squared, plus 2 x g(x) 1 5 2 10 3 15

Answers: 2

Answer

You know the right answer?

Pls answer the university is on a bearing of 050° from the stadium and 300° from the hospital

Questions

Geography, 22.03.2021 22:00

I’ll mark brainliest if correct! What nation has the United States taken a special interest in due to their massive oil reserves? a. Argentina

Biology, 22.03.2021 22:00

Which state of matter would be described as having low energy, with particles that are fixed in place and their only motion is vibrating? * 1 point

French, 22.03.2021 22:00

Claim 100 pts! and the first to answer gets brainliest!! :)...

Chemistry, 22.03.2021 22:00

Use the balanced "ham sandwich" equation from the concept, repeated below. 2H +C+T +5P + 2B + H2CTP5B2 Which is NOT a possibl...

Mathematics, 22.03.2021 22:00

Imagine that the number 3 button on your calculator is damaged and cannot be used. Use a flowchart to show 4 different ways in which you can calculate...

English, 22.03.2021 22:00

What conclusion can be drawn about infectious diseases, based on this timeline?...

Mathematics, 22.03.2021 22:00

Does anyone know the answer to these? You just answer one or both oh, it's too confusing for me

Chemistry, 22.03.2021 22:00

What are all the intermolecular forces present in a sample of BrF? ion-dipole London Hydrogen bonding dipole-dipo...

Mathematics, 22.03.2021 22:00

What additional information do you need to prove ∆ABC ≅ ∆DEF by the SAS Postulate? A.) ∠CAB ≅ ∠FDE B.) ∠BCA ≅ ∠EFD C.) ∠ABC ≅...

Computers and Technology, 22.03.2021 22:00

Multiple controllers are probably necessary due to the scale of the cloud. Is it beneficial to have system and application controllers? Should the con...

Mathematics, 22.03.2021 22:00

Find the radius of a volume of a sphere that is 4,188.8 cubic feet...

Mathematics, 22.03.2021 22:00

Solve for m: m + 13 = 7 A. m = 20 B. m = -6 C. m = -20 D. m = 6...

Mathematics, 22.03.2021 22:00

Find the values of x and y. ...

Mathematics, 22.03.2021 22:00

Hi I need help pls Due in 10 mins ...

Mathematics, 22.03.2021 22:00

PLS HELP WITH THIS LAST QUEASTION ILL MARK BRAINLIEST I DONT NEED STEP BY STEP JUST THE ANSWER ASAP

Mathematics, 22.03.2021 22:00

Steve is a part of a Goodwill organization that paints houses for people in need. Each house he paints requires 9 and 3/4 cans of paint....

Mathematics, 22.03.2021 22:00

Fully simplify somebody help me please ...

Biology, 22.03.2021 22:00

What is the exons and the intron in this dna strand? ATCTCTTGCCAGATAGTGTGA TACAGAACGGTCTATCACACT...

Mathematics, 22.03.2021 22:00

Make V the subject of the formula A=c/2m(v²-u²)...

Biology, 22.03.2021 22:00

Dr. Alex Young would like to know about your progress in solving the mystery about the rough-skinned newts. In the space below, answer the Chapter 1 Q...

More questions: Mathematics Another questions

Pls answer the university is on a bearing of 050° from the stadium and 300° from the hospital mark the position of the university on the map with a cross (x)

Answers

Another question on Mathematics

Pls answer the university is on a bearing of 050° from the stadium and 300° from the hospital

mark the position of the university on the map with a cross (x)