subject
Biology, 22.03.2021 22:00 organicmemez

What is the exons and the intron in this dna strand? ATCTCTTGCCAGATAGTGTGA TACAGAACGGTCTATCACACT​

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 21:00
If water is at -10 ° c and energy is added to the water until it is 50 ° c while maintaining a constant pressure of 760 mmhg, describe the phase change of the water?
Answers: 2
question
Biology, 22.06.2019 02:00
The accompanying figure shows the percent of selected dna sequences that match between a chimpanzee and other primates. these data support the hypothesis that the figure shows the percentage of selected d n a sequences that match between the chimpanzee and other primates. the human has an almost 98 percent match, the gorilla has an almost 97 percent match, the orangutan has a 96 percent match, the gibbon has an almost 95 percent match, and the old world monkey has an almost 92 percent match. the accompanying figure shows the percent of selected dna sequences that match between a chimpanzee and other primates. these data support the hypothesis that the figure shows the percentage of selected d n a sequences that match between the chimpanzee and other primates. the human has an almost 98 percent match, the gorilla has an almost 97 percent match, the orangutan has a 96 percent match, the gibbon has an almost 95 percent match, and the old world monkey has an almost 92 percent match. chimpanzees and gibbons are the most closely related the chimpanzee's closest surviving relative is humans orangutans are the primates least closely related to chimpanzees old world monkeys and gibbons are the most closely related
Answers: 1
question
Biology, 22.06.2019 07:20
Some tools have graduations to show multiple measurements. for example, a ruler may have graduations for both millimeters and centimeters. when measuring the length of an earthworm, which graduations would allow for the most accurate measurement? millimeters centimeters decimeters meters
Answers: 2
question
Biology, 22.06.2019 10:50
Overtime the pond slowly becomes more acidic due to the release of chemicals from a nearby factory. which of the organisms would most likely survive the change to their environment?
Answers: 1
You know the right answer?
What is the exons and the intron in this dna strand? ATCTCTTGCCAGATAGTGTGA TACAGAACGGTCTATCACACT​...
Questions
Questions on the website: 13722365