subject

Engineering, 13.10.2019 04:20 jack487

Task 1-
give illustrations and or descriptions of how the following forces would appear in structure under load.
•shear
•tension
•compression
•stress
•strain

task 2
predict the simple structural behaviour of the following -show using drawings:
•a steel portal frame overloaded at the bolted junction with the column •an overloaded and undersized concrete lintel spanning a window opening
•a strip foundation designed to take a load of 30 n/mm2, which is actually subjected to a load of 50 n/mm 2

ansver

Answers: 1

Show answers

Another question on Engineering

question

Engineering, 03.07.2019 15:10

Ahouse has the following electrical appliance usage (1) single 40w lamp used for 4 hours per day (2) single 60w fan used for 12 hours per day (3) single 200w refrigerator that runs 24 hours per day with compressor run 12 hours and off 12 hours find the solar power inverter size in watt with correction factor of 1.25.

Answers: 1

question

Engineering, 04.07.2019 16:10

An electrical motor raises a 50kg load at a construct velencity .calculate the power of the motor, if it takes 40sec to raise the load through a height of 24m(take g =9.8n/g)

Answers: 2

question

Engineering, 04.07.2019 18:10

Coiled springs ought to be very strong and stiff. si3n4 is a strong, stiff material. would you select this material for a spring? explain.

Answers: 2

question

Engineering, 04.07.2019 18:10

Apipe with an outside diameter of 15 cm is exposed to an ambient air and surrounding temperature of -20°c. the pipe has an outer surface temperature of 65°c and an emissivity of 0.85. if the rate of heat loss from the pipe surface is 0.95 kw per meter of length, the external convective heat transfer coefficient (h) is: (a) 12.5 w/m"k (b) 18.6 w/mk (c) 23.7 w/mk (d) 27.9 w/mk (e) 33.5 w/mk

Answers: 1

You know the right answer?

Task 1-
give illustrations and or descriptions of how the following forces would appear in st...

Questions

question

Biology, 04.04.2020 13:59

Twenty-five people developed symptoms of nausea, vomiting, and diarrhea three to six hours after attending a church picnic where they ate a ham and gr...

question

History, 04.04.2020 13:59

How many representatives are there in the U. S. House of Representatives ( Lower House)?...

question

Business, 04.04.2020 13:59

A writer’s company has just adopted a policy of employee e-mail surveillance to determine which employee is leaking confidential information. Because...

question

Chemistry, 04.04.2020 13:59

The reaction below has a Kp value of 3.3 × 10-5. What is the value of Kc for this reaction at 700 K? Note: Type the correct answer with 1 decimal plac...

question

Mathematics, 04.04.2020 13:59

An isocost line Question 7 options: 1) represents the combinations of w and K that cost the firm the same amount of money. 2) represents the combinati...

question

Mathematics, 04.04.2020 13:59

Thirty-six of the staff of 80 teachers at a local intermediate school are certified in Cardio-Pulmonary Resuscitation (CPR). In 180 days of school, ab...

question

Mathematics, 04.04.2020 13:59

PLEASE HELP I WILL MARK BRAINLIEST...

question

Mathematics, 04.04.2020 13:59

PLEASE!! Dinah invests $850 in a high-yield savings account. The account pays 3% simple interest annually. Is it reasonable that Dinah wil...

question

Biology, 04.04.2020 13:59

Which steps are part of the process during the formation of molded fossils? Check all that apply. Sediment hardens into rock. Sedime...

question

Mathematics, 04.04.2020 13:59

PLEASE HELP WILL NAME BRAINLIEST...

question

Computers and Technology, 04.04.2020 14:00

Which of the following is true of data collection:. a. Data collection is of secondary importance to computer security. b. Data collection should not...

question

Physics, 04.04.2020 14:00

An air-plane has an effective wing surface area of 17.0 m² that is generating the lift force. In level flight the air speed over the top of the wings...

question

Biology, 04.04.2020 14:00

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along thi...

question

Chemistry, 04.04.2020 14:00

2.00 moles of an ideal gas was found to occupy a volume of 17.4L at a pressure of 3.00 atm and at a temperature of 45 C. Calulate the value of the cas...

question

Mathematics, 04.04.2020 14:00

A group of n people enter an elevator in a building with k floors. Each person independently selects a floor uniformly at random (each with equal prob...

question

Chemistry, 04.04.2020 14:01

What is likely to be true about the ∆H for this reaction? C6H6 (l) → C6H6 (s) ∆H>0 ∆H=0 ∆H<0...

question

Mathematics, 04.04.2020 14:01

Cole is studying employment trends.He found that 20% of the social workers he surveyed, or 45 social workers,work part time. How many soci...

question

Business, 04.04.2020 14:01

A 12-year bond of a firm in severe financial distress has a coupon rate of 12% and sells for $920. The firm is currently renegotiating the debt, and i...

question

Business, 04.04.2020 14:01

Magic Milling Company has 9% annual coupon bonds that are callable and have 18 years left until maturity. The bonds have a par value of $1,000, and th...

question

Mathematics, 04.04.2020 14:01

He assignment problem is . ANSWER Unselected a specialized form of an optimization model that attempts to assign limited capacity to various demand po...

More questions: Engineering Another questions

Questions on the website: 13722363