3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' 5'

Type of mutation (3pts):

Amino acid ( 3pts):

Type of mutation ( 3pts):

4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mutated DNA sequence: 3' 5'

Type of mutation ( 3pts) :

Amino acid ( 3pts):

Type of mutation ( 3pts):

1. desertification

2. captive breeding

3. black rhinoceros

4. renewable resources

explanation:

mark brainliest!

preservation because he preserves part of the land and preserves means save

explanation:

evidence and logical support is essential for a scientist to do in order to maintain credibility. this is because no one can believe without any logic and without any evidence.hence a scientist can maintain credibility by proving himself and by answering logically so experiments prove very beneficial. logical hypothesis give conclusion which is acceptable. therefore, there are two main factors to maintain credibility by a scientist is evidence and logical support.

flooding wildfire landslides climate change the factors listed have an immediate effect on the animal populations found in any habitat. the four factors would lead to a death. b emigration. eliminate c immigration. d mutations.