subject
Biology, 06.12.2021 09:50 ayoismeisjjjjuan

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' 5'

Type of mutation (3pts):

Amino acid ( 3pts):

Type of mutation ( 3pts):

4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mutated DNA sequence: 3' 5'

Type of mutation ( 3pts) :

Amino acid ( 3pts):

Type of mutation ( 3pts):

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 05:50
Is there any species that went extinct in recent years due to natural causes (not caused by human interaction). if so, what caused it?
Answers: 1
question
Biology, 22.06.2019 15:30
(me out over the last several centuries, scientists have made the following broad observations while investigating several branches of the life sciences: -the fossil record shows that different types of organisms have existed at different times in earth's history. -many organisms have similar body structures that seem to be adapted to different ways of living in their environment. -organisms of different species often share similarities in stages of embryonic development. -many species share genetic similarities, and almost all organisms use the same basic building blocks to construct proteins. -often, the extent of two species' similarities can be predicted from their geographic closeness to each other. -a great deal of change has been observed among species that have experienced strong selective pressures through many generations. scientists have carefully considered and rigorously tested the observations listed above. when scientists offer a of these observations, they are making 1.) testable explanation, deductive explanation 2.) scientific interference, scientific law
Answers: 3
question
Biology, 22.06.2019 16:00
In an hydrogen ion pump the energy is used to join small molecules together to make larger ones which factor most likely has the greatest effect on the number of molecules mitochondria can produce
Answers: 2
question
Biology, 22.06.2019 16:30
In a leaf, dermal tissue a) stores food b) stores carbon dioxide c) releases oxygen into the air d) transports water from the roots
Answers: 1
You know the right answer?
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' 5'

Type...
Questions
question
History, 23.04.2021 19:50
question
Mathematics, 23.04.2021 19:50
question
Mathematics, 23.04.2021 19:50
question
Mathematics, 23.04.2021 19:50
question
Social Studies, 23.04.2021 19:50
question
Mathematics, 23.04.2021 19:50
Questions on the website: 13722367