What would be the primary structure of this small protein made from the following DNA sequence?
TACTCTGATAATGCCGTCATT

Aplant with dark red flowers is crossed with a plant with white flowers. all of the offspring have dark red flowers with white spots. the alleles got flower color in this plant are both dominant both recessive codominant incompletely dominant

Which is not true about balanced forces?

Below are the three main organs that make up the plant body.