subject

Biology, 30.06.2019 03:00 utjfkdndidndldn62121

What is the dna compliment to the given strand tacgtatgccgtatgggcatt

ansver

Answers: 1

Show answers

Another question on Biology

question

Biology, 21.06.2019 16:30

Which of the following is not a main characteristic that scientists focus on when determining which kingdom an organism belongs to

Answers: 3

question

Biology, 22.06.2019 00:00

Monitor and apply fix up strategies

Answers: 3

question

Biology, 22.06.2019 01:30

What macromolecule is produced during translation? a. carbohydrate b. rna c. dna d. protein

Answers: 2

question

Biology, 22.06.2019 03:00

Which set of characteristics best describes sedimentary rock? a) largest type of rock, made of organic matter, hardest type of rock b) often contains layers, forms near sources of water, contains fossils c) least abundant type of rock, made of other rocks, made mostly of minerals d) most abundant type in earth's crust, made of magma/lava, contains no fossils

Answers: 2

You know the right answer?

What is the dna compliment to the given strand tacgtatgccgtatgggcatt...

Questions

question

Physics, 27.07.2020 01:01

Let’s measure precisely how much electromotive force the generator can produce. The amount of electromotive force is measured in volts. In fact, elect...

question

History, 27.07.2020 01:01

Describe the different ways that people tried to cope with economic hardships during the Great Depression...

question

Chemistry, 27.07.2020 01:01

1L of bleach has a mass of 1,100 grams, 7.25% of the mass of bleach is NaClO, 1 mol of NaClO has a mass of 74.44 grams. What is the molarity (mol/L) o...

question

Mathematics, 27.07.2020 01:01

A pony ride at a carnival gives the children rides in a circular pattern. The pony can only walk 500 feet before it needs to drink some water or it wi...

question

English, 27.07.2020 01:01

I need help fast i dont really know what i have to do HELP

question

Mathematics, 27.07.2020 01:01

Please answer this now in two minutes ...

question

Mathematics, 27.07.2020 01:01

Exercise 6-4 Blossom Company sells a snowboard, EZslide, that is popular with snowboard enthusiasts. Below is information relating to Blossom Company’...

question

English, 27.07.2020 01:01

In which sentence is the underlined phrase an adverb phrase?1. In which sentence is the underlined phrase an adverb phrase? Mr. Bruns had...

question

Business, 27.07.2020 01:01

At the beginning of 2016, EZ Tech Company's Accounts Receivable balance was $140,000, and the balance in Allowance for Doubtful Accounts was $2,350 (C...

question

Computers and Technology, 27.07.2020 01:01

Would you expect all the devices listed in BIOS/UEFI setup to also be listed in Device Manager? Would you expect all devices listed in Device Manager...

question

Mathematics, 27.07.2020 01:01

7. The Marine Corps is ordering hats for all the new recruits for the entire next year. Since they do not know the exact hat sizes they will use stati...

question

Business, 27.07.2020 01:01

(Factoring) Your firm has an average collection period of 31 days. Current practice is to factor all receivables immediately at a discount of 1.25 per...

question

Biology, 27.07.2020 01:01

Why was there not a significant difference in the reaction rate with 800 mg of substrate as compared to 400 m. of substrate? What would you need to ad...

question

Social Studies, 27.07.2020 01:01

A metropolitan police department is trying to stop a conflict between two gangs that occupy the same neighborhood. Which suggestion is NOT one a psych...

question

Social Studies, 27.07.2020 01:01

Jason is serving a two-year mission for his church at the age of 18. When he returns home from his mission assignment, he will decide whether or not t...

question

Business, 27.07.2020 01:01

Analyzing existing workforce demographics, comparing them to relevant labor markets, and setting goals for correcting under representation describes ,...

question

Computers and Technology, 27.07.2020 01:01

The variable dp is to refer to an array of double. Assuming the integer variable n has been assigned a value, declare dp appropriately, allocate an ar...

question

Social Studies, 27.07.2020 01:01

When a study is completed, researchers have Group of answer choices no further responsibility to the participants. a responsibility to follow them fo...

question

Business, 27.07.2020 01:01

The base year in the consumer price index (CPI) is:. a) established by law. b) given a value of zero. c) a year chosen as a reference f...

question

English, 27.07.2020 01:01

TMacbeth is similar to the character Oedipus in Oedipus the King by Sophocles. Earlier in the story, he gets in a fight with a man riding a chariot,...

More questions: Biology Another questions

Questions on the website: 13722367