This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place. ATTTGCATACTACCGGGC The red letters are the noncoding region, and the black letters are the protein coding region. ATTAGCATACTACGGGC ATTTGCATACTGACCGGGC ATTTGCAATACTACCGGGC ATTTGCAACTACCGGGC ATGAATGCATACTACCGGGC

Read the paragraph and answer the question that follows: the town of belmond, iowa, needs to add weather sirens. the loud and steady wail would warn citizens of approaching danger. if past history is an indication, the sirens will save hundreds of lives. with a prediction of a deadly storm season, the alert which sentence should be revised to eliminate redundancy? the town of belmond, iowa, needs to add weather sirens. the loud and steady wail would warn citizens of approaching danger. if past history is an indication, the sirens will save hundreds of lives. with a prediction of a deadly storm season, the alert system is needed immediately.