This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The red letters are the noncoding region, and the black letters are the protein coding region.
ATTAGCATACTACGGGC
ATTTGCATACTGACCGGGC
ATTTGCAATACTACCGGGC
ATTTGCAACTACCGGGC
ATGAATGCATACTACCGGGC
Answers: 1
Another question on Physics
Physics, 21.06.2019 20:20
When many atoms are split in a chain reaction, a large explosion occurs. this is an example of what type of energy conservation
Answers: 2
Physics, 22.06.2019 06:30
In positive numbers less than 1, the zeros between the decimal point and a non-zero number are blank significant
Answers: 1
Physics, 23.06.2019 07:00
Calculate the linear momentum of a pickup truck that has a mass of 1000kg, and is traveling eastward at 20 m/s
Answers: 1
Physics, 23.06.2019 07:00
A55-kg pilot flies a jet trainer in a half vertical loop of 1200-m radius so that the speed of the trainer decreases at a constant rate. knowing that the plane has a speed of 550 km/h at point a, and the pilot experiences weightlessness at point c (i.e., the normal force from the seat bottom is zero), determine (a) the deceleration of the plane, (b) the force exerted on her by the seat of the trainer when the trainer is at point b.
Answers: 2
You know the right answer?
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the se...
Questions
Business, 28.06.2019 09:20
Mathematics, 28.06.2019 09:20
Physics, 28.06.2019 09:20
Chemistry, 28.06.2019 09:20
English, 28.06.2019 09:20
History, 28.06.2019 09:20
Biology, 28.06.2019 09:20
History, 28.06.2019 09:20
