Mathematics, 16.02.2022 14:00 sebby33

1/2(m-3/4) =-1 2/5 solve for m

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 17:00

What is sin 7x/4 ? i need on this urgent trig

Answers: 1

Answer

Mathematics, 22.06.2019 01:00

Urgent? will give brainliest to the first correct answer what is the area of the figure?

Answers: 3

Answer

Mathematics, 22.06.2019 02:20

At a cost of 200, your club bought 175 frisbees to sell at the pep rally. you plan on selling them for $5 each. what is the domain of the function?

Answers: 1

Answer

Mathematics, 22.06.2019 04:50

What number produces an irrational number when multiplied by 1/4

Answers: 3

Answer

You know the right answer?

1/2(m-3/4) =-1 2/5 solve for m...

Questions

Mathematics, 02.07.2019 18:00

On the day she was born, a baby leopard had 9 spots. each day 4 more appeared. after 5 days, how many spots did the baby leopard have?...

Mathematics, 02.07.2019 18:00

Write 44/3 as a whole or mixed number in simplest form.3 2/1414 2/32 3/1414 3/44...

Mathematics, 02.07.2019 18:00

21 pts. what are the intersections of the graphs of these equations with the x-axis? y=0.4x−12...

Mathematics, 02.07.2019 18:00

The table shows the approximate height of a football after it is kicked. tell whether the rates of change are constant or variable...

Chemistry, 02.07.2019 18:00

What does it mean if the plus sign is positive for the sodium atom?...

Mathematics, 02.07.2019 18:00

Sam worked 8.4 hours each day for 7 days. how many hours did he work altogether...

Biology, 02.07.2019 18:00

5' atgcccgggtgtcgtagttga3' complete the complementary sequence for the template strand...

History, 02.07.2019 18:00

Briefly summarize how christianity split into catholicism and protestantism...

Geography, 02.07.2019 18:00

The microscope most commonly used for cell study is called the...

Biology, 02.07.2019 18:00

What are the seven levels of classification...

Mathematics, 02.07.2019 18:00

Identify the type of dilation and find the scale factor...

Mathematics, 02.07.2019 18:00

Gabriella swims 2 laps per minute. what is the unit rate?...

Mathematics, 02.07.2019 18:00

How many numbers can you think of that have 3 tens...

Mathematics, 02.07.2019 18:00

Neha used 4 banana and 5 oranges i her fruit salad. daniel used 7 bananas and 9 oranges. did neha and daniel use the same ratio of bananas to oranges?...

Mathematics, 02.07.2019 18:00

Show me how to solve 384 divided by 55...

Mathematics, 02.07.2019 18:00

Answer if u can will mark brainest show work...

Biology, 02.07.2019 18:00

Semi-permeable structure to contain all of the cell parts and to control what goes and comes out of the cell...

Chemistry, 02.07.2019 18:00

How r nonmetals classified 1st gets brainliest...

Biology, 02.07.2019 18:00

Do trees perform photosynthesis during winter...

Mathematics, 02.07.2019 18:00

Mandie wants to put some lace trim around the outside of a round tablecloth she expanded. the original tablecloth had a radius of 2 ft. and a circumfe...

More questions: Mathematics Another questions