subject

Mathematics, 29.11.2021 23:50 famousshorty

2 2/4*2 1/3 what is the answer to this multiplicatron problem

ansver

Answers: 3

Show answers

Another question on Mathematics

question

Mathematics, 22.06.2019 02:50

What is the value of x in the equation 3x4y65, when y=4?

Answers: 1

question

Mathematics, 22.06.2019 06:00

Abag contains 50 jolly ranchers of 30% of the jolly ranchers are green how many green jolly ranchers are in the bag

Answers: 1

question

Mathematics, 22.06.2019 06:30

Anutrition company is marketing a low calorie snack brownie. a serving size of the snack is 3 brownies and has a total of 50 calories. determine how many calories 21 brownies would have

Answers: 1

question

Mathematics, 22.06.2019 07:00

Swimming fleury swam 6 laps the first day,15 laps the second day,24 laps the third day, and so on.on which day will fleury swim 51 laps if the pattern continues?

Answers: 2

You know the right answer?

2 2/4*2 1/3 what is the answer to this multiplicatron problem...

Questions

question

Mathematics, 04.10.2020 18:01

Which rule describes the composition of transformations that maps ΔBCD to ΔB"C"D"? Translation of 5 units x, negative 6 units y composition reflection...

question

Mathematics, 04.10.2020 18:01

Emily bought forty eight crayons that came in packs of 4. How many packs of crayons did dan buy?...

question

Mathematics, 04.10.2020 18:01

Two similar triangles are shown below: Two triangles are shown. The sides of the triangle on the left are marked 6, 4, 3. The sides of the triangle o...

question

Physics, 04.10.2020 18:01

Suppose a force of N is required to stretch and hold a spring m from its equilibrium position. a. Assuming the spring obeys Hooke's law, find the spri...

question

Biology, 04.10.2020 18:01

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?...

question

Computers and Technology, 04.10.2020 18:01

The process of determines what volume a system can handle by comparing its performance to standards in the industry....

question

Mathematics, 04.10.2020 18:01

7. There are 1000 different components in the system that your department has just designed. The objective is that for each of the systems that you de...

question

History, 04.10.2020 18:01

Amin 3. How are the New England Colonies alike?...

question

Biology, 04.10.2020 18:01

Who Believed that species could inherit traits that would help them adapt and survive within an environment...

question

Geography, 04.10.2020 18:01

Earth's physical layers in sequence...

question

Mathematics, 04.10.2020 18:01

Given the figure below, find the values of x and z. (14x + 55) (10x + 29)...

question

History, 04.10.2020 18:01

Which amendment protects citizens from being forced to house troops? O the First Amendment O the Third Amendment O the sixth Amendment

question

Chemistry, 04.10.2020 18:01

Which rate describes a unit price? A.$1.00 for 2 lemons B.$3.00 for every pound C.$4.00 for 3 slices of pizza D.$6.00 for every 6 b...

question

History, 04.10.2020 18:01

From the time of the Declaration of Independence until the ratification of the Constitution, the United States functioned without more than two...

question

Mathematics, 04.10.2020 18:01

1) Solve for x. Х– 4 = -12 А. -8 В.-16 С.16 D.8 ОА Ов Ос OD HINT SUBMIT...

question

Physics, 04.10.2020 18:01

A 2-kg sample of a metal increases in temperature by 20°C when heated on a stove for 3 minutes. Can you predict what will happens to the temperature r...

question

Computers and Technology, 04.10.2020 18:01

(Python experience) In this exercise you will create simulated data and will fit regression models to it. To create the data use the random module fro...

question

Social Studies, 04.10.2020 18:01

What are four cities located in the Coastal Plains region of Texas...

question

Business, 04.10.2020 18:01

On December 31, 2016, the accounts of Leuz Architect Services showed credit balances in its Common Stock and Retained Earnings accounts of $60,000 and...

question

Biology, 04.10.2020 18:01

Which step of the nitrogen cycle occurs only in aquatic ecosystems? A. Cyanobacteria convert nitrogen into ammonium B. Soil bacteria convert ni...

More questions: Mathematics Another questions

Questions on the website: 13722361