Mathematics, 03.06.2021 21:10 kaneisha20

Fill out chart will give brainlest if corect

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 19:00

In trapezoid abcd, ac is a diagonal and ∠abc≅∠acd. find ac if the lengths of the bases bc and ad are 12m and 27m respectively.

Answers: 3

Answer

Mathematics, 21.06.2019 22:30

What is 1.5% of 120 or what number is 1.5% of 120

Answers: 2

Answer

Mathematics, 21.06.2019 22:40

What rotation was applied to triangle def to create d’e’f’?

Answers: 2

Answer

Mathematics, 21.06.2019 23:30

What are the measures of angles a, b, and c? show your work and explain your answers. 25 points

Answers: 1

Answer

You know the right answer?

Fill out chart will give brainlest if corect
...

Questions

Mathematics, 11.03.2021 01:00

plz plzz help my mom said if i get my math grade and pass 9th grade she will let me get my learners perment during summer so plz help i really wanna g...

Mathematics, 11.03.2021 01:00

A new pair of jeans costs $129. 97 and the sales tax rate is 8.38%. You only have $140 to spend. Do you have enough money to purchase the jeans? Expla...

Biology, 11.03.2021 01:00

Question 12 of 20 Which of the following are goals of the Convention on Biological Diversity? 1. Conservation II. Sustainable uses...

Mathematics, 11.03.2021 01:00

CAN SOMEONE PLSSS HELP ME ...

Mathematics, 11.03.2021 01:00

WILL GIVE BRAINLST hAVE AN AMAZING DAY ...

Biology, 11.03.2021 01:00

The respiratory system controls , and the circulatory systems controls . 1. antibodies; digestion 2. breathing; blood flow 3. muscles; bo...

English, 11.03.2021 01:00

In paragraphs 3-4, how does the author make the connection between facial recognition and reading emotions? by explaining how reading emo...

Mathematics, 11.03.2021 01:00

Answer and explain I’ll mark brainliest ...

English, 11.03.2021 01:00

1. How do the citizens react to the fighting ? Why might they feel this way ?...

History, 11.03.2021 01:00

Under Roosevelt's New Deal program, which group below would NOT have been one of the first helped?...

Mathematics, 11.03.2021 01:00

A DVD has a diameter of 12 centimeters. What is the area of the DVD? Round your answer to the nearest hundreth. Use 3.14 for Pi. (Remember A = 3.14 ·...

Biology, 11.03.2021 01:00

Please help me The DNA base sequence for a short gene is TATGATACCTTGATAGCTATGTGATTG What is the amino acid sequence of the polypeptide p...

Mathematics, 11.03.2021 01:00

Help me plz ill give extra points ...

Mathematics, 11.03.2021 01:00

The line L passes through the point p (2,4) and Q (6,10) calculate:the gradient of line L...

Physics, 11.03.2021 01:00

Order the imagines of earth plates in order from oldest of earliest...

Mathematics, 11.03.2021 01:00

PLEASE HELP Is A'B'C'D' a translation, rotation, or reflection of ABCD? Explain how you can tell.

Mathematics, 11.03.2021 01:00

Randi and Craig ride their bikes at constant speeds. It takes Randi 6 hours to travel 18 miles. Craig can bike 10 miles in 5 hours , If Randi gi...

Mathematics, 11.03.2021 01:00

Si boss de toy story sabe que no es un muñeco, porque se queda quieto cuando llega andy...

Mathematics, 11.03.2021 01:00

A recent survey found that 71% of all adults over 50 wear sunglasses for driving. In a random sample of 60 adults over 50, what is the mean and standa...

Mathematics, 11.03.2021 01:00

Split the number 76 into the ratio 6:3:7:3 ....

More questions: Mathematics Another questions