Mathematics, 07.05.2021 04:10 sosa71

Here is an inequality: -2x > 10. How are the solutions to the inequality -2x > 10 different from the solutions to
-2x 10? Explain your reasoning.

Answers: 3

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 14:00

Can you decompose the numbers 20,740,6,000

Answers: 1

Answer

Mathematics, 21.06.2019 19:00

What is the factored form of the following expressions? d^2 – 13d + 36

Answers: 2

Answer

Mathematics, 21.06.2019 20:30

For f(x) = 3x+1 and g(x) = x2 - 6, find (g/f)(x)

Answers: 1

Answer

Mathematics, 21.06.2019 21:30

Suppose y varies directly with x. write a direct variation equation that relates x and y. then find the value of y when x=12 y=7 when x=3

Answers: 1

Answer

You know the right answer?

Here is an inequality: -2x > 10. How are the solutions to the inequality -2x > 10 different...

Questions

Biology, 28.10.2019 21:31

Consider the following mrna strand: ccauggcaaaggagugacuaa a. what dna sequence would encode for this mrna? provide the sequence in form (sing...

Biology, 28.10.2019 21:31

What is the main advantage of a sole proprietorship?...

Physics, 28.10.2019 21:31

Development of life goals, access to community resources, long-term counseling, and accountability are all examples of case management....

Mathematics, 28.10.2019 21:31

Ababy woolly mammoth that was discovered in 2007 died approximately 39,000 years ago. how many c-14 atoms per 1.0 × 108 c-12 atoms would have be...

Mathematics, 28.10.2019 21:31

Use the method in the example to find the square roots of 1 + √3i...

Business, 28.10.2019 21:31

The term ""insecure laboratory procedures"" in the definition of a biohazard presented in this educational module refers to which element of biohazard...

Business, 28.10.2019 21:31

The town of genter recently witnessed a devastating hurricane that crippled the town's infrastructure. q-mart, a retail chain that plans to open a new...

Mathematics, 28.10.2019 21:31

Which is an example of gaining a static charge by conduction?...

Social Studies, 28.10.2019 21:31

Which general conclusion did issac newton observation of gravity have on the way we understand the universe...

Mathematics, 28.10.2019 21:31

Which of the inequalities matches the statement? "a number y, increased by 14 is greater than 22" a)y-14> 22 b)y-14<...

Social Studies, 28.10.2019 21:31

What signals the adrenal glands to produce more of the hormones adrenaline and cortisol and release them into the bloodstream?...

Biology, 28.10.2019 21:31

What properties of water allow water to move up the stem of a plant and overcome gravity?...

English, 28.10.2019 21:31

The unique structure of the opening lines of bart edelman’s poem "they shot wook kim" is meant to convey what main idea? select all that apply.

Engineering, 28.10.2019 21:31

The walls of a furnace are made of 1.6-ft-thick concrete (k = 0.64 btu/h⋅ft⋅°f and α = 0.023 ft2/h). initially, the furnace and the surrounding air ar...

Mathematics, 28.10.2019 21:31

The vertices of a rectangle are given in the columns of the matrix r- roo 3 31-1 0 3 3 0 0 xr is found to perform...

Mathematics, 28.10.2019 21:31

The x- and y-coordinates of the focus of a parabola are (1,3) and the directrix is y=-5 . a second parabola is a translation 1 unit right and 2 units...

Health, 28.10.2019 21:31

There are two main levels of responsibility related to fitness and fire apparatus operations and preventing injuries and line of duty deaths. the firs...

English, 28.10.2019 21:31

1complete the following analogy: president : secretary : : king : a queen b kingdom c beggar d

History, 28.10.2019 21:31

Think about how this situation compares to what you’ve already learned. how was the situation in the black hills similar to the situation...

English, 28.10.2019 21:31

This is the combination of ways that an author shows readers what a person in a literary selection is like. example: revealing the perso...

More questions: Mathematics Another questions

Here is an inequality: -2x > 10. How are the solutions to the inequality -2x > 10 different from the solutions to -2x 10? Explain your reasoning.

Answers

Another question on Mathematics

Here is an inequality: -2x > 10. How are the solutions to the inequality -2x > 10 different from the solutions to
-2x 10? Explain your reasoning.