Mathematics, 05.05.2021 04:20 Kennabug4503

There is a circle with a diameter of 3. Round to nearest tenth!

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 17:00

Two streets intersect at a 30- degree angle. at the intersection, the are four crosswalks formed that are the same length. what type of quadrilateral is formed by the crosswalks?

Answers: 3

Answer

Mathematics, 21.06.2019 17:10

If angle 2=3x +1 and angle 3=2x +4what is angle 2

Answers: 1

Answer

Mathematics, 21.06.2019 19:30

Nikolas calculated the volume of the prism. his work is shown below.

Answers: 1

Answer

Mathematics, 21.06.2019 19:30

Liz had 140 pens and inna had 100 pens. after inna gave liz some pens, liz had 3 times as many pens as inna. how many pens did inna give liz?

Answers: 2

Answer

You know the right answer?

There is a circle with a diameter of 3. Round to nearest tenth!...

Questions

English, 21.01.2021 22:30

How does Sawides' Lego explanation help explain how...

History, 21.01.2021 22:30

HELP FAST!! On this it’s a test ...

English, 21.01.2021 22:30

Read this sentence from the speech. But different men often see the same subject in different lights; and, therefore, I hope it will not be thought d...

Mathematics, 21.01.2021 22:30

Kristina walked 1 2/3 miles on Sunday and 2 3/4 miles on Monday. What was the total distance, in miles, that she walked over those two days...

Biology, 21.01.2021 22:30

Which statement best describes the interdependence of photosynthesis and cellular respiration? A. The reactants of photosynthesis are sugar and oxyge...

Computers and Technology, 21.01.2021 22:30

Write a simple program where you create an array of single byte characters. Make the array 100 bytes long. In C this would be an array of char. Use po...

Mathematics, 21.01.2021 22:30

A person in a boat floating in a small pond throws an anchor overboard. What happens to the level of the pond...

Mathematics, 21.01.2021 22:30

jogs every three days andjogs every four days. if today is a wednesday and and both jog today, in how many days will they both jog again on the same d...

Computers and Technology, 21.01.2021 22:30

Match the appropriate words to complete the paragraph. Wireless networks have no clear boundaries, therefore securing communications requires strong (...

Chemistry, 21.01.2021 22:30

a solution of dextrose contains 25.0 g solute in 250.0 g water. how should the percentage by mass of dextrose in this solution be calculated...

Chemistry, 21.01.2021 22:30

Green plants absorb sunlight to power photosynthesis, the chemical synthesis of food from water and carbon dioxide. The compound responsible for light...

History, 21.01.2021 22:30

WHY IS DRAKE SO FRGGIN COOOLIO ??? LIKE I LOVE HIM HAHAHAH ANYWAYS I NEED HELP ANS FRIEDNDSS HAHAHAHA...

Biology, 21.01.2021 22:30

Given the following DNA strand TACGTATGCCGTATGGGCATT a) What is the DNA compliment to given strand?b) What is the mRNA compliment to the...

English, 21.01.2021 22:30

Part B: Which quotation from heart of darkness best supports that answer to part A...

Business, 21.01.2021 22:30

At the end of 2017, Stacky Corp. had $500,000 in liabilities and a debt-to-assets ratio of 0.5. For 2017, Stacky had an asset turnover of 3.0. What we...

Mathematics, 21.01.2021 22:30

A2+7b+3a+4 what statements can best describe this expression...

History, 21.01.2021 22:30

Where did the Europeans have more of a presence & influence around 1500? a. Americas b. Antarctica c. Asia d. Australia...

Mathematics, 21.01.2021 22:30

The pie chart shows the favorite retail clothing store of a group of teenagers. About what percentage of teenagers prefer ForLess? v%

English, 21.01.2021 22:30

Symbolism in crucible...

English, 21.01.2021 22:30

Who can relate to this song? has nothing to do with now...please don't report It's the start of a new day But it feels as though everything's e...

More questions: Mathematics Another questions