Mathematics, 02.05.2021 01:00 freyaocain

What are the coordinates of the centroid of LMN?
A B C D

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 20:30

Which expression is equivalent to (4 +6i)^2? ? -20 + 48i 8 + 12i 16 - 36i 20 + 48i

Answers: 1

Answer

Mathematics, 21.06.2019 23:00

If a company produces x units of an item at a cost of $35 apiece the function c=35x is a of the total production costs

Answers: 2

Answer

Mathematics, 22.06.2019 01:30

Given the functions, f(x) = 2x^2 - 1 and g(x) = 5x, find f(g(x)) and g(f(

Answers: 2

Answer

Mathematics, 22.06.2019 03:00

Alayna wonders how much water it would take to fill her cup she drops her pencil in her cup and notices that it just fits diagonal the pencil is 17 cm long and the cup is 15 cm tall how much water can the cup hold

Answers: 2

Answer

You know the right answer?

What are the coordinates of the centroid of LMN?
A B C D
...

Questions

English, 15.04.2020 03:53

The main idea is usually found after the topic sentence. True False...

Mathematics, 15.04.2020 03:53

What is the approximate area of the figure ?...

Social Studies, 15.04.2020 03:54

Jane enters into a contract with Jill to provide 100 roses for a dinner party. Jill fails to deliver the roses. Jane initiates a suit against Jill, as...

Business, 15.04.2020 03:54

Suppose that when the price of wheat is $2 per bushel, farmers can sell 10 million bushels. When the price of wheat is $3 per bushel, farmers can sell...

Biology, 15.04.2020 03:54

Multicellular organisms evolved from three different ancestral lineages: stramenopiles, unikonts, and archaeplastids. Of these, fungi and animals evol...

Physics, 15.04.2020 03:54

The plates of a parallel-plate capacitor are 2.50 mm apart, and each carries a charge of magnitude 77.0 nC. The plates are in vacuum. The electric fie...

Business, 15.04.2020 03:54

Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b....

Biology, 15.04.2020 03:54

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...

Mathematics, 15.04.2020 03:54

A newly constructed fish pond contains 1000 liters of water. Unfortunately, the pond has been contaminated with 5 kg of a toxic chemical during the co...

Mathematics, 15.04.2020 03:54

1. Write the polynomial in standard form. Identify the degree and leading coefficient of the polynomial. $-3p^3+5p^6-4$ The polynomial i...

Mathematics, 15.04.2020 03:54

Mitch wants to buy a camera. The sale price is $291. What was the original price? 25% off original price....

Computers and Technology, 15.04.2020 03:54

We have the following functional dependencies: course_no, student_id -> grade course_no -> course_name We have the followin...

Physics, 15.04.2020 03:54

A man unloads a 4.0-kg box from a moving van by giving it an initial speed of 1.1 m/s down a ramp that makes an angle of 18° with the horizontal. It s...

Business, 15.04.2020 03:54

One reason new products fail is that although most major corporations use a formal decision-making process, sometimes they fail to critically evaluate...

Health, 15.04.2020 03:54

Max is a seven-month-old baby who was abandoned at an orphanage. He does not get enough nutrition and has not put on any weight in the last few months...

Business, 15.04.2020 03:54

A large retail organization previously divided work among its four employee-benefitsstaff into distinct specializations. One person answered all quest...

Mathematics, 15.04.2020 03:54

Engineers want to design seats in commercial aircraft so that they are wide enough to fit 99 % of all males. (Accommodating 100% of males would requir...

Medicine, 15.04.2020 03:54

Tuberculosis is a serious bacteria infection. If you become infected with tuberculosis you will?...

History, 15.04.2020 03:54

The image on the right shows Mary Vecchio reacting to a student who had been shot by antiwar protestors antiwar officials the...

Advanced Placement (AP), 15.04.2020 03:54

Imagine imagining things worthless to spend money on bro Free Points lol...

More questions: Mathematics Another questions

What are the coordinates of the centroid of LMN? A B C D

Answers

Another question on Mathematics

What are the coordinates of the centroid of LMN?
A B C D