Mathematics, 15.04.2021 01:00 meccadm

I know how to solve the equation with the quadratic formula but i don't understand THIS specific question. Please help

I know how to solve the equation with the quadratic formula but i don't understand THIS specific qu

Answers: 3

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 19:30

If you can solve all of these i will give ! - 4% of 190 - 4% of 162.5 - 4% of 140 - a 4% increase from 155.1 - a 4% increase from 159.8

Answers: 2

Answer

Mathematics, 21.06.2019 20:50

Find the missing variable for a parallelogram: a = latex: 32in^2 32 i n 2 h = b = 6.3 in (1in=2.54cm)

Answers: 2

Answer

Mathematics, 21.06.2019 22:20

Which strategy is used by public health to reduce the incidence of food poisoning?

Answers: 2

Answer

Mathematics, 21.06.2019 23:10

Which best describes the function on the graph? direct variation; k = −2 direct variation; k = -1/2 inverse variation; k = −2 inverse variation; k = -1/2

Answers: 2

Answer

You know the right answer?

I know how to solve the equation with the quadratic formula but i don't understand THIS specific que...

Questions

Mathematics, 15.04.2020 03:53

A scatterplot is used to display data where x is the amount of time, in minutes, one member can tolerate the heat in a sauna, and y is the temperature...

Mathematics, 15.04.2020 03:53

QUESTION 1 To what was Douglass referring when he wrote 'From that moment, I understood the pathway from slavery to freedom. It was just what I...

Business, 15.04.2020 03:53

A manufacturer of hospital supplies has a uniform annual demand for 320,000 boxes of bandages. It costs $10 to store one box of bandages for one year...

Business, 15.04.2020 03:53

Engineering, 15.04.2020 03:53

A household refrigerator that has a power input of 450 W and a COP of 2.5 is to cool five large watermelons, 10 kg each, to 8°C. If the watermelons ar...

Mathematics, 15.04.2020 03:53

In 5-card poker, played with standard 52-card deck, 2,598,960 difficult hands are possible. If there are 624 different ways a "four-of-a-kind" can be...

Business, 15.04.2020 03:53

Hofstede studied how culture influences consumer behavior. When a Japanese company decides that it will be willing to lose money for twenty years in a...

Physics, 15.04.2020 03:53

Even though Alice visits the wishing well frequently and always tosses in a coin for good luck, none of her wishes have come true. As a result, she de...

Business, 15.04.2020 03:53

Identify the items as consumer programs or consumer information sources local chambers of commerce consumer reports state cons...

English, 15.04.2020 03:53

Kite Runner Quiz Chapters 1-5 1. The novel begins with a flashback. What do you think is its purpose? What do you learn about the narrator? 2. Who is...

Computers and Technology, 15.04.2020 03:53

Which of the following is not a true statement? a. Data flow diagrams and flowcharts are difficult to prepare and revise using software packages. b. D...

Business, 15.04.2020 03:53

Consider the equation %ΔM + %ΔV ≈ %ΔP + %ΔY. If the velocity of money does not change (%ΔV = 0), and the change in real GDP exactly keeps pace with th...

English, 15.04.2020 03:53

The main idea is usually found after the topic sentence. True False...

Mathematics, 15.04.2020 03:53

What is the approximate area of the figure ?...

Social Studies, 15.04.2020 03:54

Jane enters into a contract with Jill to provide 100 roses for a dinner party. Jill fails to deliver the roses. Jane initiates a suit against Jill, as...

Business, 15.04.2020 03:54

Suppose that when the price of wheat is $2 per bushel, farmers can sell 10 million bushels. When the price of wheat is $3 per bushel, farmers can sell...

Biology, 15.04.2020 03:54

Multicellular organisms evolved from three different ancestral lineages: stramenopiles, unikonts, and archaeplastids. Of these, fungi and animals evol...

Physics, 15.04.2020 03:54

The plates of a parallel-plate capacitor are 2.50 mm apart, and each carries a charge of magnitude 77.0 nC. The plates are in vacuum. The electric fie...

Business, 15.04.2020 03:54

Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b....

Biology, 15.04.2020 03:54

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...

More questions: Mathematics Another questions