subject

Mathematics, 02.04.2021 06:00 brendaesme

Help asap for brainlist.

Help asap for brainlist.

ansver

Answers: 2

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 19:10

Which equation results from adding the equations in this system? x+6y=9 and -x+2y=-15

Answers: 1

question

Mathematics, 21.06.2019 19:30

Boris needs to buy plastic spoons. brand a has a box 42 spoons for $2.37. brand b has a box of 72 spoons for $3.57. find the unit price for each brand. then state which brand is the better buy based on the unit price. round your answer to the nearest cent.

Answers: 1

question

Mathematics, 22.06.2019 03:00

Determine if the sequence is arithmetic or geometric. then identify the next term in the sequence. 0.2, 1, 5, 25, . . group of answer choices arithmetic; 75 geometric; 75 arithmetic; 125 geometric; 125

Answers: 1

question

Mathematics, 22.06.2019 03:40

The following numbers will result in a quotient that is less than 1 when it is divided by ? a.2% e. 1 and 2/3 b.x2 f. 1/5 c. 3/10 g. 7/15 d. 5/9

Answers: 1

You know the right answer?

Help asap for brainlist.
...

Questions

question

Chemistry, 29.12.2021 04:10

if, at equilibrium, the concentration of glucose 6-phosphate is greater than the concentration of glucose 1-phosphate, is the δg′° of the reaction pos...

question

English, 29.12.2021 04:10

Who wrote the poem how do i love thee let me count the ways...

question

Mathematics, 29.12.2021 04:10

What is the greatest common factor shared by 40 and 20? Answer here SUBMIT...

question

History, 29.12.2021 04:10

what groups formed during protests of the stamp act that continued on throughout the american revolution?...

question

SAT, 29.12.2021 04:10

It is impossible to circumscribe a circle about the quadrilateral below....

question

History, 29.12.2021 04:10

In what ways did WWII-era policies deliver prosperity to white veterans and their families while preventing the same for Americans and veterans of col...

question

English, 29.12.2021 04:10

I hesitated long before I put this theory to the test of practice. I knew well that I risked death; for any drug that so potently controlled and shook...

question

SAT, 29.12.2021 04:10

The population density of orangeland is 18 orange trees per acre. Exactly 792 orange trees grow in orangeland. How many acres are in orangeland?....

question

SAT, 29.12.2021 04:10

Kent multiplies both sides of the equation below by an expression. K + startfraction 12 over k endfraction = 8 then he moves all the terms to one side...

question

SAT, 29.12.2021 04:10

Compare the character of faustus at the beginning of the play with his character at the end. How have his character traits and basic ambitions shifted...

question

Biology, 29.12.2021 04:10

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA...

question

SAT, 29.12.2021 04:10

A stone fell from the top of a cliff into the ocean. In the air, it had an average speed of 161616 \text{m/s}m/sstart text, m, slash, s, end text. In...

question

Mathematics, 29.12.2021 04:10

What is 18 1/5 -7 3/5 as a mixed number in simplest form...

question

SAT, 29.12.2021 04:10

What are the typical sources of data which is used for data analytics....

question

Chemistry, 29.12.2021 04:10

Which of these describes a human activity that uses up a non-renewable resource? building new roads that cause topsoil to erode chopping...

question

SAT, 29.12.2021 04:10

Which general trends in atomic radius and electronegativity are observed....

question

Health, 29.12.2021 04:10

a couple undergoes a workup for infertility, which shows that the man has a low sperm count. the couple asks why this is a problem because it only tak...

question

SAT, 29.12.2021 04:10

Which of these factors would be considered when making a location decision at the region or community level?....

question

Mathematics, 29.12.2021 04:10

Find the domain of f(x). f(x) = √9x+36...

question

SAT, 29.12.2021 04:10

Consider this reaction: 2h+ + co32- → h2o + co2. Identify each of the following as a product, a reactant, or a coefficient. Co32-: h2o: co2: the 2 in...

More questions: Mathematics Another questions

Questions on the website: 13722361