Mathematics, 08.12.2020 01:00 kimbllumi

What is the degree measure of f?

A) 37°

B) 53°

C) 56°

D) 71°

What is the degree measure of f?A) 37°B) 53°C) 56°D) 71°

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 13:50

Samantha swam upstream for some distance in one hour. she then swam downstream the same river for the same distance in only 12 minutes. if the river flows at 4 mph, how fast can samantha swim in still water?

Answers: 1

Answer

Mathematics, 21.06.2019 16:00

If f(x)= 3x+6 which of the following is the inverse of f(x)

Answers: 2

Answer

Mathematics, 21.06.2019 19:50

Given that abcd is a rhombus, what is the value of x?

Answers: 3

Answer

Mathematics, 21.06.2019 22:20

Jimmy can run 3.5 miles in 20 minutes. how far can ne run in one hour and ten minutes?

Answers: 1

Answer

You know the right answer?

What is the degree measure of f?

A) 37°

B) 53°

C) 56°

D)...

Questions

English, 20.07.2019 06:00

What is the prepositional phrase in this sentence? across the street you will also see a small neighborhood park. a. you will b. across the street c....

Biology, 20.07.2019 06:00

Chromosomes are found in pairs, one from the father and mother. a. nonsister b. haploid c. homologous d. chromatids...

History, 20.07.2019 06:00

The rich banking family from florence...

Mathematics, 20.07.2019 06:00

Enter the slope-intercept equation of the line that has slope -5 and y intercept (0, 8)...

Mathematics, 20.07.2019 06:00

On average 113,204 aluminum cans are recycled in a minute. approximately how many cans will be recycled in 16 days? (express your answer in scientifi...

Mathematics, 20.07.2019 06:00

M the most recent model of an atom is the a. bohr model b. einstein model c. nucleus model d. electron cloud model (this is actually science)...

Mathematics, 20.07.2019 06:00

Ithought about this but not who can me understand this...

Chemistry, 20.07.2019 06:00

What phase change occurs during evaporation?...

Mathematics, 20.07.2019 06:00

What is the value of x in the solution to this system of linear equations? 4x - 3y = 3...

English, 20.07.2019 06:00

Which of the following is true about the mayflower compact? a. the colony would be based on church of england beliefs. b. it created the massachusett...

Biology, 20.07.2019 06:00

Pl find mrna and a. a sequnce to this sickle cell hemoglobin dna- cacgtggactgaggacacctc sickle cells hemglobin mrna- sickle cell shemoglobin a. a s...

History, 20.07.2019 06:00

The dust bowl described what great depression situation?...

History, 20.07.2019 06:00

True or false while in school at jerusalem paul may have stayed at the home of his married sister...

Biology, 20.07.2019 06:00

Which step happens first in dna replication? a. protein is formed from the dna. b. base pairs are broken apart. c. the replication fork forms. d. the...

Mathematics, 20.07.2019 06:00

The average person drinks one pint of milk a day at this rate how many gallons will a person drink in 366 days...

Mathematics, 20.07.2019 06:00

Jerry is a judge. he hears 555 cases every 2 3/8. jerry hears cases at a constant rate. how many cases does he hear per hour?...

History, 20.07.2019 06:00

What do you think is the most important aspect of social studies that is used to define humans and their societies? are there any subject areas that...

English, 20.07.2019 06:00

What is the purpose of “the declaration of sentiments”? what viewpoint does it convey about women’s rights? how does the structure to convey the pu...

History, 20.07.2019 06:00

What divided the eastern and western europe after ww2...

English, 20.07.2019 06:00

Would someone answer this question will be and also will pick ( be honest)...

More questions: Mathematics Another questions