subject

Mathematics, 16.10.2020 19:01 slbucknerholmes9

Fill in the blanks with line, linear, constant, and rate of change. The slope tells you how much the y-value of a point changes each time the x-value increases by 1 unit. This is called the . When one quantity changes at a rate relative to another, there is a relationship between the quantities, which is graphed as a .

ansver

Answers: 3

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 15:20

Acourgette seed and a pumpkin seed is planted p(courgette seed germinates) 4/5 and p(pumpkin seed germinates) = 1/6 what is the probability that both seds germinate

Answers: 2

question

Mathematics, 21.06.2019 18:30

The final cost of a sale is determined by multiplying the price on the tag by 75%. which best describes the function that represents the situation?

Answers: 1

question

Mathematics, 21.06.2019 20:30

The cost for an uberi is $2.50 plus $2.00 mile. if the total for the uber ride was $32.50, how many miles did the customer travel?

Answers: 3

question

Mathematics, 21.06.2019 21:30

Look at the figure below: triangle abc is a right triangle with angle abc equal to 90 degrees. the length of ac is 5 units and the length of ab is 4 units. d is a point above c. triangle adc is a right triangle with angle dac equal to 90 degrees and dc parallel to ab. what is the length, in units, of segment cd?

Answers: 1

You know the right answer?

Fill in the blanks with line, linear, constant, and rate of change. The slope tells you how much th...

Questions

question

Business, 15.04.2020 03:53

Consider the equation %ΔM + %ΔV ≈ %ΔP + %ΔY. If the velocity of money does not change (%ΔV = 0), and the change in real GDP exactly keeps pace with th...

question

English, 15.04.2020 03:53

The main idea is usually found after the topic sentence. True False...

question

Mathematics, 15.04.2020 03:53

What is the approximate area of the figure ?...

question

Social Studies, 15.04.2020 03:54

Jane enters into a contract with Jill to provide 100 roses for a dinner party. Jill fails to deliver the roses. Jane initiates a suit against Jill, as...

question

Business, 15.04.2020 03:54

Suppose that when the price of wheat is $2 per bushel, farmers can sell 10 million bushels. When the price of wheat is $3 per bushel, farmers can sell...

question

Biology, 15.04.2020 03:54

Multicellular organisms evolved from three different ancestral lineages: stramenopiles, unikonts, and archaeplastids. Of these, fungi and animals evol...

question

Physics, 15.04.2020 03:54

The plates of a parallel-plate capacitor are 2.50 mm apart, and each carries a charge of magnitude 77.0 nC. The plates are in vacuum. The electric fie...

question

Business, 15.04.2020 03:54

Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b....

question

Biology, 15.04.2020 03:54

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...

question

Mathematics, 15.04.2020 03:54

A newly constructed fish pond contains 1000 liters of water. Unfortunately, the pond has been contaminated with 5 kg of a toxic chemical during the co...

question

Mathematics, 15.04.2020 03:54

1. Write the polynomial in standard form. Identify the degree and leading coefficient of the polynomial. $-3p^3+5p^6-4$ The polynomial i...

question

Mathematics, 15.04.2020 03:54

Mitch wants to buy a camera. The sale price is $291. What was the original price? 25% off original price....

question

Computers and Technology, 15.04.2020 03:54

We have the following functional dependencies: course_no, student_id -> grade course_no -> course_name We have the followin...

question

Physics, 15.04.2020 03:54

A man unloads a 4.0-kg box from a moving van by giving it an initial speed of 1.1 m/s down a ramp that makes an angle of 18° with the horizontal. It s...

question

Business, 15.04.2020 03:54

One reason new products fail is that although most major corporations use a formal decision-making process, sometimes they fail to critically evaluate...

question

Health, 15.04.2020 03:54

Max is a seven-month-old baby who was abandoned at an orphanage. He does not get enough nutrition and has not put on any weight in the last few months...

question

Business, 15.04.2020 03:54

A large retail organization previously divided work among its four employee-benefitsstaff into distinct specializations. One person answered all quest...

question

Mathematics, 15.04.2020 03:54

Engineers want to design seats in commercial aircraft so that they are wide enough to fit 99 % of all males. (Accommodating 100% of males would requir...

question

Medicine, 15.04.2020 03:54

Tuberculosis is a serious bacteria infection. If you become infected with tuberculosis you will?...

question

History, 15.04.2020 03:54

The image on the right shows Mary Vecchio reacting to a student who had been shot by antiwar protestors antiwar officials the...

More questions: Mathematics Another questions

Questions on the website: 13722363