History, 24.09.2019 16:30 sabrinakholikov

True or false? mass communication has create a global village

Answers: 1

Show answers

Another question on History

History, 21.06.2019 19:30

Which amendment best addresses the fears of the federalists like james madison,that rights and powers not specifically listed in the consttuition or bill of rights will not be protected in the future

Answers: 1

Answer

History, 22.06.2019 00:00

Were african-americans allowed to serve in the military in wwi?

Answers: 2

Answer

History, 22.06.2019 01:00

What was the focus of the stanford study-pls

Answers: 1

Answer

History, 22.06.2019 01:40

How do developments in the us space program during the ford administration reflect the foreign policy of president ford

Answers: 1

Answer

You know the right answer?

True or false? mass communication has create a global village...

Questions

English, 06.12.2021 08:30

Identify and write the prepositional phrases in the following sentences. 1. Did your car stall on the viaduct? Mine did that once, when I was drivin...

Engineering, 06.12.2021 08:40

6.03 Discussion: Then & Now - Safety Discussion Topic I'm Done In this unit, you have learned about the evolution of the industry’s...

Biology, 06.12.2021 08:40

Which statement best describes adaptation: A. A lily suddenly mutates its tissues to store more water in a drought. B. Fish swim away from sudden sour...

English, 06.12.2021 08:40

What do these lines from stanza 5 reveal about the Pardoner? I stand up like a scholar in a pulpit, And when the ignorant people all do sit,

Mathematics, 06.12.2021 08:40

The amount of milk available per child in a day care center is given by the function Mlu)= where x is the number of children and is the quantity of...

Mathematics, 06.12.2021 08:40

Select of the equivalent representations of 1/10x10x10...

English, 06.12.2021 08:40

class 6to 11 students come here I will give you notes class is started come plz plz and it is free class no fee need fast come students plz plz plz pl...

Mathematics, 06.12.2021 08:40

A 4. An architect made a scale drawing on a grid of the front of an arch for a public park. Each box on the architect's grid measures 1...

Chemistry, 06.12.2021 08:40

Please help me with this I need this asap because submission of mine is 4:00 pm

Mathematics, 06.12.2021 08:40

Newton's Second Law of Motion states that the acceleration of an object is directly proportional to the force exerted on the object. If an object ac...

Mathematics, 06.12.2021 08:40

In general, the mechanical advantage of a simple machine is... A. please help quick the amount of force needed with the machine...

Mathematics, 06.12.2021 08:40

Pls help asap thx 1. Mr. Voeller and his band want to play at a venue in Oakland, but it is a gig that will last all night long. As a teacher...

History, 06.12.2021 08:40

From 1775-1825 what issue most divided the United States?...

History, 06.12.2021 08:40

Plz answer quick if u can i need it soon ...

Mathematics, 06.12.2021 08:40

What is solve 10<-2/3(9+12b)...

Mathematics, 06.12.2021 08:40

I need help what is the square root of 5*12/5...

Computers and Technology, 06.12.2021 08:40

Fill in the blacks 1-9 are my answer options for 10-12

Biology, 06.12.2021 08:40

1. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACATCCGCTTACGTCTGATCGCT 5' Type of mutation ( 3pts):

Mathematics, 06.12.2021 08:40

I need help finals are crushing me pls help ...

Mathematics, 06.12.2021 08:40

V. Directions: Answer the following questions. Show your solution, 10. What is the smallest decimal number with two decimal places that becomes 0.5...

More questions: History Another questions