Write a python program that converts an input file in fasta format, called
"fasta. txt", to an...
![subject](/tpl/images/cats/informatica.png)
Computers and Technology, 17.12.2019 05:31 duhitsmiracle59
Write a python program that converts an input file in fasta format, called
"fasta. txt", to an output file in phylip format called "phylip. txt".
for example if the input file contains:
> human
accgttatac
cgatctcgca
> chimp
acggttatac
cgtacgatcg
> monkey
acctctatac
cgatcgatcc
> gorilla
atctatatac
cgatcgatcg
then the output file should be
human accgttataccgatctcgca
chimp acggttataccgtacgatcg
monkey acctctataccgatcgatcc
gorilla atctatataccgatcgatcg
fasta format has a description (indicated with a '> ') followed by 1 or
more lines of a dna sequence. phylip format has a description followed
by a single line of a dna sequence and each sequence is the same length.
for this homework, the input file will have an arbitrary number of
sequences of arbitrary, but identical, length
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Computers and Technology
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 22.06.2019 11:30
Andrina writes letters that are regularly sent to hundreds of her company’s customers. because of this, she would like for the mail merge command to be in her quick access toolbar, and she wants it to be the first button on the left. what should andrina do to place the mail merge button there?
Answers: 1
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 22.06.2019 23:00
In which part of a professional email should you try to be brief, but highly descriptive?
Answers: 1
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 23.06.2019 18:00
File account.java (see previous exercise) contains a definition for a simple bank account class with methods to withdraw, deposit, get the balance and account number, and return a string representation. note that the constructor for this class creates a random account number. save this class to your directory and study it to see how it works. then write the following additional code: 1. suppose the bank wants to keep track of how many accounts exist. a. declare a private static integer variable numaccounts to hold this value. like all instance and static variables, it will be initialized (to 0, since it’s an int) automatically. b. add code to the constructor to increment this variable every time an account is created. c. add a static method getnumaccounts that returns the total number of accounts. think about why this method should be static - its information is not related to any particular account. d. file testaccounts1.java contains a simple program that creates the specified number of bank accounts then uses the getnumaccounts method to find how many accounts were created. save it to your directory, then use it to test your modified account class.
Answers: 3
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 23.06.2019 20:30
If an appliance consumes 500 w of power and is left on for 5 hours, how much energy is used over this time period? a. 2.5 kwh b. 25 kwh c. 250 kwh d. 2500 kwh
Answers: 1
You know the right answer?
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 02.07.2019 11:30
![question](/tpl/images/cats/istoriya.png)
History, 02.07.2019 11:30
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 02.07.2019 11:30
![question](/tpl/images/cats/istoriya.png)
History, 02.07.2019 11:30
![question](/tpl/images/cats/mat.png)
Mathematics, 02.07.2019 11:30
![question](/tpl/images/cats/biologiya.png)
Biology, 02.07.2019 11:30
![question](/tpl/images/cats/istoriya.png)
History, 02.07.2019 11:30
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 02.07.2019 11:30
![question](/tpl/images/cats/informatica.png)
Computers and Technology, 02.07.2019 11:30
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 02.07.2019 11:30
![question](/tpl/images/cats/mat.png)
Mathematics, 02.07.2019 11:30
![question](/tpl/images/cats/mat.png)
Mathematics, 02.07.2019 11:30
![question](/tpl/images/cats/User.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 02.07.2019 11:30
![question](/tpl/images/cats/mat.png)
Mathematics, 02.07.2019 11:30