Chemistry, 02.10.2019 07:00 krishimotam

In the balanced reaction and using the mole ratio:
ch4 + 2 o2 → co2 + 2 h2o
how many moles of oxygen are required to burn 6 moles of methane (ch4 )?
a. 2
b. 6
c. 24
d. 12

Answers: 1

Show answers

Another question on Chemistry

Chemistry, 22.06.2019 07:00

At 450 mm hg a gas has a volume of 760 l, what is its volume at standard pressure

Answers: 2

Answer

Chemistry, 22.06.2019 08:30

Name the element in group 17, period 2. (periodic table)

Answers: 3

Answer

Chemistry, 22.06.2019 15:00

What energy is it when you flip on a switch on a lamp

Answers: 1

Answer

Chemistry, 22.06.2019 17:30

The polymer used for the nonstick surface of cooking utensils is 24.0%c and 76%f by mass. what is the empirical formula of this polymer?

Answers: 2

Answer

You know the right answer?

In the balanced reaction and using the mole ratio:
ch4 + 2 o2 → co2 + 2 h2o
how many mo...

Questions

Mathematics, 11.12.2019 18:31

Let x be the normal distribution with mean μ=−19 μ = − 19 and variance 16 16 for some value of z...

Mathematics, 11.12.2019 18:31

Which of the following is a logarithmic function?...

History, 11.12.2019 18:31

What type of music is traditional?...

Mathematics, 11.12.2019 18:31

Which of the following is not a step in finding the interest from a simple interest table? a. divide the principal by $100 to find the number o...

Chemistry, 11.12.2019 18:31

Can you find the quotient of 1/4 of 3...

Spanish, 11.12.2019 18:31

Select the word from the list that best fits the definition viene del mar....

Mathematics, 11.12.2019 18:31

The population parameters below describe the full-time equivalent number of students (ftes) each year at lake tahoe community college from 1976–1977 t...

Law, 11.12.2019 18:31

Researchers who study the causes of crime are called?...

Mathematics, 11.12.2019 18:31

Suppose a 95% confidence interval for the average amount of weight loss on a diet program for males is between 13.0 and 18.0 pounds. these results wer...

Business, 11.12.2019 18:31

Zhao co. has fixed costs of $255,000. its single product sells for $157 per unit, and variable costs are $107 per unit. the company expects sales of 1...

Chemistry, 11.12.2019 18:31

What is the concentration of a solution of hcl in which a 10.0 ml sample of acid required 50.0 ml of 0.150 m naoh for neutralization? what is the con...

Biology, 11.12.2019 18:31

Denaturation of nucleic acids a duplex dna oligonucleotide in which one of the strands has the sequence taatacgactcactataggg has a melting temperature...

Business, 11.12.2019 18:31

Vesting refers to; a. how long until an employee owns any employer contributions to the employee's pension plan. b. how long until an e...

Chemistry, 11.12.2019 18:31

For which of the following will the entropy of the system increase? a. condensation of steam b. reaction of magnesium with oxygen to for...

Chemistry, 11.12.2019 18:31

What is wrong with the following mechanism? h2o 2) br br there is no leaving group, so there should be no arrows. a. b. the arrow should be removing...

Mathematics, 11.12.2019 18:31

When light passes from a more-dense to a less-dense medium—from glass to air, for example—the angle of refraction predicted by snell's law can be 90°...

Physics, 11.12.2019 18:31

When a hammer thrower releases her ball, she is aiming to maximize the distance from the starting ring. assume she releases the ball at an angle of 31...

Mathematics, 11.12.2019 18:31

What is the main difference between the explanation for the effect size for a one-way between-subjects anova and the one-way repeated measures anova?...

History, 11.12.2019 18:31

Many changes that have happened in american history started with one person standing up for what they believed in and others joining them in their cau...

Business, 11.12.2019 18:31

Abeekeeper lives adjacent to an apple orchard. the orchard owner benefits from the bees because each hive pollinates about one acre of apple trees. th...

More questions: Chemistry Another questions

In the balanced reaction and using the mole ratio: ch4 + 2 o2 → co2 + 2 h2o how many moles of oxygen are required to burn 6 moles of methane (ch4 )? a. 2 b. 6 c. 24 d. 12

Answers

Another question on Chemistry

In the balanced reaction and using the mole ratio:
ch4 + 2 o2 → co2 + 2 h2o
how many moles of oxygen are required to burn 6 moles of methane (ch4 )?
a. 2
b. 6
c. 24
d. 12