Biology, 22.07.2019 11:30 alishbaqadeer1
They took the human insulin gene and inserted it into a plasmid to make a recombinant plasmid. then they transformed the bacteria - which means they had the bacteria take up the plasmid. then they grew the transformed bacteria, the bacteria made insulin through protein synthesis and they isolated the insulin. brilliant!
Answers: 1
Biology, 21.06.2019 19:00
Which of the following structures is not found in both plant and animal cells? a) chloroplast b) cytoskeleton c) ribosomes d) mitochondria
Answers: 2
Biology, 22.06.2019 00:00
You decide that the introduction should also discuss the extremophiles that are referred to as the archaea. these single-cell organisms are considered "extremophiles" due to their ability to survive and reproduce in environmental conditions that would be hostile for most living organisms. archaea species have been isolated from highly acidic sulfur springs, ocean floor thermal vents with temperatures that exceed boiling, and subarctic ice well below freezing. while still considered to be prokaryotic, the archaea have numerous differences that place them apart from the bacteria. choose the characteristics that separate the archaea from other prokaryotic cells. select all that apply. view available hint(s) select all that apply. archaea lack true peptidoglycan in their cell walls. the morphology of the cell is rigid and is geometric in shape, similar to a sphere or cylinder. the cytoplasmic membrane lipids of archaea have branched or ringform hydrocarbon chains. all currently identified and characterized archaea have been linked as the causative agent to an animal or human disease.
Answers: 2
Biology, 22.06.2019 05:50
Is there any species that went extinct in recent years due to natural causes (not caused by human interaction). if so, what caused it?
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
They took the human insulin gene and inserted it into a plasmid to make a recombinant plasmid. then...
Physics, 17.01.2021 22:40
Mathematics, 17.01.2021 22:40
Mathematics, 17.01.2021 22:40
Mathematics, 17.01.2021 22:40
Mathematics, 17.01.2021 22:40
Computers and Technology, 17.01.2021 22:40
History, 17.01.2021 22:40
Mathematics, 17.01.2021 22:40
Mathematics, 17.01.2021 22:40
Biology, 17.01.2021 22:40