subject
Biology, 24.07.2019 04:30 reticentrobbie

Will mark brainest what would happen if the deer population was removed? question 3 options: the trees in the area will grow and provide more food for the moose. there will be less food for the ermine, so they will need to look for a new food source. there would be more food for the caribou and the porcupine, so these populations would flourish. the insect population will decrease, and the skunk will need to find another food source.

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 18:50
Football players often sustain lateral blows to the extended knee. which of the ligaments is (are) damaged as a result? a. suprapatellar b. oblique popliteal and extracapsular ligament c. medial collateral, medial meniscus, and anterior cruciate d. arcuate popliteal and the posterior cruciate
Answers: 2
question
Biology, 22.06.2019 05:30
Food webs - transferring energy and matter from one level to another. here you see four food webs. one or more are incorrect. which food web(s) show the correct sequence of organisms, from start to top level consumer? a) a b) d c) c d) a and d
Answers: 2
question
Biology, 22.06.2019 09:10
In general, are there any major differences that you can see? explain
Answers: 3
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Will mark brainest what would happen if the deer population was removed? question 3 options: the...
Questions
question
Mathematics, 05.11.2019 02:31
Questions on the website: 13722363