Answers: 1
Biology, 21.06.2019 23:30
Considering the yellow and green pea color phenotypes studied by gregor mendel: a. what is the biochemical function of the protein that is specified by the gene responsible for the pea color phenotype? (1 point) b. a null allele of a gene is an allele that does not specify (or encode) any of the biochemical function that the gene normally provides (in other words, either no protein at all or only non-functional protein is produced from it). of the two alleles, y and y, which is more likely to be a null allele? (1 point) c. in terms of the underlying biochemistry, why is the y allele dominant to the y allele? (2 points) d. why are peas that are yy homozygotes green? (1 point) e. the amount of protein produced from a gene is roughly proportional to the number of functional copies of the gene carried by a cell or individual. what do the phenotypes of yy homozygotes, yy heterozygotes, and yy homozygotes tell us about the amount of sgr enzyme needed to produce a yellow color? explain your reasoning. (2 points)
Answers: 1
Biology, 22.06.2019 03:40
Organisms that successfully adapt will leave to grownone of the above
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 21:00
Do anyone know who mrs leddy is from duval charter if so me on the homework for 40 points
Answers: 1
How is a microclimate different from a climate...
Mathematics, 16.04.2020 20:32
Mathematics, 16.04.2020 20:32
Law, 16.04.2020 20:32
Mathematics, 16.04.2020 20:32
Mathematics, 16.04.2020 20:32
Mathematics, 16.04.2020 20:32
Medicine, 16.04.2020 20:32
History, 16.04.2020 20:33