Biology, 25.07.2019 05:30 drubio102004
Machines have moving parts and electronics that can overheat in some situations. engineers use metal heat sinks to the heat escape from the machine. a heat sink is made of metal and usually has fins, which give the heat sink a large surface area. why is it important for heat sinks to be made of metal and have a large surface area?
Answers: 1
Biology, 21.06.2019 19:30
Chicken pox and hepatitis are bacterial diseases. true or false?
Answers: 1
Biology, 22.06.2019 06:20
The science for classifying and naming organisms is known as
Answers: 2
Biology, 22.06.2019 11:50
Which of the following describes how binary fission and mitosis are similar? a)they are both used for growth or repair b)they both break down membrane-bound nuclei c)both invoke the replication of a single stand of dna d)both replicate genetic material
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Machines have moving parts and electronics that can overheat in some situations. engineers use metal...
Physics, 29.06.2019 17:10
Mathematics, 29.06.2019 17:10