subject
Biology, 28.07.2019 09:00 laquiataylor948

How are meiosis and mitosis different? a. mitosis produces haploid cells and meiosis produces diploid cells. b. chromatids are formed only during the process of meiosis. c. in mitosis, cells go through telophase, but in meiosis, they do not. d. only meiosis results in a reduction in chromosome number.

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 15:50
Each trait of a plant is determined a. an allele b. one gene c. a pair of genes d. one dominant gene
Answers: 1
question
Biology, 22.06.2019 05:40
Why do we perceive objects as retaining their brightness under different lighting levels?
Answers: 1
question
Biology, 22.06.2019 11:00
What is the best conclusion based on this data? the hypothesis was not supported because the data indicated that fertilizing plants does not improve plant growth. the hypothesis was supported; to get the best growth, use 5 milliliters of fertilizer per plant. the hypothesis was not supported; the data indicated that too much fertilizer can inhibit plant growth. the hypothesis was supported; to get the best growth, use 15 milliliters of fertilizer per plant.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
How are meiosis and mitosis different? a. mitosis produces haploid cells and meiosis produces diplo...
Questions
question
English, 29.04.2021 15:50
question
English, 29.04.2021 15:50
Questions on the website: 13722367