Fishermen often claim that fish are more likely to strike at bait when it is raining because the fish react to the raindrops on the surface of the water as if they were potential food. this response is considered a behavior because the fish are responding to a stimulus in their

Which of these is true of the cytoplasm of an unfertilized egg? a. it is an unevenly distributed mixture of mrna, proteins, organelles, and other substances. b. it does not contain substances that are important in directing development. c. these substances are supplied by the sperm. d. it does not contain substances that are important in directing development. e. development is directed solely by the surrounding cells. f. it is a homogeneous mixture of mrna, proteins, organelles, and other substances. g. it does not contain substances that are important in directing development. h. these substances are produced by the dna of the fertilized zygote.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

What are potential sources of error in marta’s experiment