Protein is found in plant and animal products.
a. true
b. false...
![subject](/tpl/images/cats/biologiya.png)
Biology, 16.09.2019 20:30 dalton200166
Protein is found in plant and animal products.
a. true
b. false
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:20
(select all the correct choose each statement that is scientific. - the opinions of randomly selected participants in a survey prove the idea that global temperatures are not increasing on earth. - the universe's average temperature and rate of expansion support the idea that it began as one super-dense and hot mass 13.8 billion years ago. - ocean tides are caused by the uneven gravitational pulls of the moon and sun on different parts of earth. - human life is more valuable than other forms of life on earth because humans are more intelligent than other organisms.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 11:30
Which benefit of the community experience when its members have a hide level of health literacy
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Is dna the same in every cell in the human body explain your answer
Answers: 2
You know the right answer?
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/en.png)
English, 31.03.2020 20:16
![question](/tpl/images/cats/es.png)
Spanish, 31.03.2020 20:16
![question](/tpl/images/cats/mat.png)
Mathematics, 31.03.2020 20:16
![question](/tpl/images/cats/mat.png)
Mathematics, 31.03.2020 20:16
![question](/tpl/images/cats/mat.png)
Mathematics, 31.03.2020 20:16
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/User.png)
Engineering, 31.03.2020 20:16
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/obshestvoznanie.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 31.03.2020 20:16
![question](/tpl/images/cats/istoriya.png)
History, 31.03.2020 20:16
![question](/tpl/images/cats/istoriya.png)
History, 31.03.2020 20:16
![question](/tpl/images/cats/mat.png)
Mathematics, 31.03.2020 20:16
![question](/tpl/images/cats/mat.png)
Mathematics, 31.03.2020 20:16
![question](/tpl/images/cats/mat.png)
Mathematics, 31.03.2020 20:16