Biology, 02.08.2019 07:30 georgehall3027

What are the body systems we use while eating?

Answers: 1

Show answers

Another question on Biology

Biology, 21.06.2019 20:00

Ineed to know why d is the correct answer asap

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

Biology, 22.06.2019 16:30

All eukaryotic cells contain small bodies called

Answers: 1

Answer

Biology, 22.06.2019 23:00

You are studying several alleles of an e. coli helicase gene. one allele, called rsr, confers resistance to rs2014, an antibiotic that works by inhibiting helicase activity. bacteria with the rss allele are sensitive to rs2014. another allele, called ts-, produces a temperature sensitive mutation of the helicase. in bacteria with the ts- allele, helicase is inactivated at 42 °c but functions normally at 37 °c. helicase functions normally at both temperatures in bacteria with the ts allele. you obtain the following data while testing four strains of e. coli at different temperatures and doses of rs2014. each number represents the percentage of maximal dna synthesis. based on this data, assign the appropriate genotype to strains a–d in the spaces provided