To which of the following dna sequences would the tata box binding protein bind? a. taggcgtatatagcgccttat b. cccgttaattaattaacgcgc c. gcgcttatctattaccgtacg d. atcgattccgatactatgcta

How does pregnancy begin? a) a placenta forms in the uterus b) a sperm reaches an egg in the fallopian tubec) the blastocyst differentiates into two cell types d) contractions begin in the uterine wallapex

What best describes lactic acid fermentation?

Drag each tile to the correct box. arrange the phases of mitosis in the correct order. 1 (condensation of chromosomes) 2 (separation of chromosomes) 3 (formation of spindle fibers) 4 (alignment of chromosomes in the center of the cell) 5 (pinching of the cell membrane)