Biology, 04.08.2019 23:00 naynay4evr
1. wegener formed the theory of continental drift in 1912. what prevented research of the ocean floor, paleomagnetism, and earthquakes at that time? plz ! i need answers
Answers: 2
Biology, 22.06.2019 02:30
Suppose you have monohybrid pea plants in your garden and find that they produce round seed to wrinkled seeds in the ratio of 3: 1. if the allele are designated (r & r) receptively. what is the probable genotypes of the round seeds which produced f 1 ? rr & rr rr only rr & rr rr only rr only
Answers: 1
Biology, 22.06.2019 06:40
The steps in the formation of extrusive igneous rocks are listed below in an incorrect order: 1. rock melts due to high temperature. 2. rock is buried deep under earth's surface. 3. magma is forced out of earth's surface during volcanic eruption. 4. lava cools and crystallizes to igneous rock. which of these best shows the correct order of steps in the formation of extrusive igneous rocks? 1, 3, 4, 2 2, 1, 3, 4 3, 4, 2, 1 4, 2, 1, 3
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 13:00
Anormal strand of dna is shown below, followed by the same strand of dna after mutations have occurred.
Answers: 3
1. wegener formed the theory of continental drift in 1912. what prevented research of the ocean floo...
Mathematics, 27.05.2021 01:00
Geography, 27.05.2021 01:00
English, 27.05.2021 01:00
Health, 27.05.2021 01:00
Computers and Technology, 27.05.2021 01:00
Mathematics, 27.05.2021 01:00
History, 27.05.2021 01:00
Mathematics, 27.05.2021 01:00
Mathematics, 27.05.2021 01:00