Brown eye-color alleles are dominant over blue eye-color alleles, which are recessive. jenna has brown eyes. her husband, bill, has blue eyes. jenna and bill are the biological parents of james, who has blue eyes. what eye-color gene alleles must jenna have? c. bb (two blue alleles) b. bb (two brown alleles) a. bb (one brown and one blue allele) d. bbb (three brown alleles)

Biology ! the conversion of inorganic carbon to organic carbon by plants during photosynthesis is known as _[blank]_. filtration immigration reabsorption primary production

What best explains whether bromine (br) or neon (ne) is more likely to form a covalent bond? bromine forms covalent bonds because it has seven valence electrons, but neon has eight valence electrons and already fulfills the octet rule. bromine forms covalent bonds because it has many electron shells, but neon has only two electron shells and is tightly bound to its electrons. neon forms covalent bonds because it can share its valence electrons, but bromine has seven valence electrons and can gain only one more electron. neon forms covalent bonds because it has only two electron shells, but bromine has many electron shells and will lose electrons in order to fulfill the octet rule.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?