subject
Biology, 25.07.2019 01:50 punani

Why do protists, plants, fungi and animals share a single domain in the three domain system?

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 19:50
What is the function of nucleic acids
Answers: 3
question
Biology, 22.06.2019 02:30
One of the purposes of transcription is to produce a sequence of bases that
Answers: 1
question
Biology, 22.06.2019 08:00
Residential construction is expanding in florida, the expansion has caused fragmentation of habitats, one of the results of the increased construction is a decrease in the number of large predators such as the coyote, black bear and pool panther, which will be the most immediate local result of this fragmentation? 1)large predators will become extinct 2)decrease in middle sized predators 3)increase in population of top carnivores 4)increase in population of prey species
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Why do protists, plants, fungi and animals share a single domain in the three domain system?...
Questions
question
English, 17.10.2020 14:01
Questions on the website: 13722366