Biology, 14.07.2019 12:10 infoneetusinghoyg22o
The group that includes human and their direct ancestors is called the
Answers: 1
Biology, 21.06.2019 18:30
This aquarium exhibits biotic and abiotic factors in an aquatic environment. one of the abiotic factors is
Answers: 3
Biology, 22.06.2019 07:00
What was the purpose of mendel's experiments with dihybrid crosses? a. to determine if dna was a transforming factor b. to determine if traits could be recessive c. to determine if traits affected each other d. to determine if traits had more than one allele
Answers: 3
Biology, 22.06.2019 07:00
Which best describes the nucleus of an atom a. it is where all of the particle s of the atom are located b. it is the negatively charged part of the atom c. it is where the electrons and the protons are located d. it is the part of the atom with the greatest mass
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
The group that includes human and their direct ancestors is called the...
Mathematics, 17.12.2021 05:20
Mathematics, 17.12.2021 05:20
Social Studies, 17.12.2021 05:20
Mathematics, 17.12.2021 05:20
English, 17.12.2021 05:20
Mathematics, 17.12.2021 05:20
History, 17.12.2021 05:20
Mathematics, 17.12.2021 05:20