subject
Biology, 14.07.2019 03:00 jae222

1. which of the following doesn't describe an mdc? a. it's highly industrialized. b. it has undergone the demographic transition. c. it generally experiences replacement reproduction. d. its age structure diagram resembles a pyramid.

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 21:00
The pattern of this wave changes between its beginning and end. what is true about the amplitude and wavelength of the wave when the pattern changes?
Answers: 3
question
Biology, 22.06.2019 02:00
If a baby girl guinea pig looks almost identical to its mother, does this then mean that it inherited more alleles from its mother? explain. (hint: think about the vocabulary words dominant and recessive.)
Answers: 1
question
Biology, 22.06.2019 02:30
One of the purposes of transcription is to produce a sequence of bases that
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
1. which of the following doesn't describe an mdc? a. it's highly industrialized. b. it has underg...
Questions
question
Social Studies, 15.10.2019 07:10
question
Mathematics, 15.10.2019 07:10
question
Mathematics, 15.10.2019 07:10
question
Chemistry, 15.10.2019 07:10
Questions on the website: 13722367