Advances in technology have many industries, including agriculture. which agricultural application is most likely to be affected by new advances in dna technology from the human genome project? a) a researcher who is investigating selective breeding of livestock b) a farmer who is planning a harvest schedule for genetically modified crops c) a plant scientist who is modifying the genetic information of crop plants in a laboratory d) a conservationist who wants to find water sources in drought-prone places

Select the correct answer.which scenario describes unethical lab behavior? a.danny stores the chemicals required for his experiment in flasks and beakers.b. anna publishes the results of her experiment on the growth rate of saplings.c. jason repeatedly runs an experiment until he gets the results he desires.d. mia records her observations of an experiment precisely and accurately.resetnext

What initially causes a nerve impulse? release of enzymes out of the neuron movement of chemicals into the dendrites of the neuron pathogens attacking the dendrites of the neuron red blood cells bathing the neuron

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?