Answers: 1
Biology, 22.06.2019 02:00
The phylogenetic tree illustrates the relationship between humans and our closest living relatives. the tree was based on biochemical comparisons, including dna and amino acid sequences. according to the biomolecular data, we could infer that a) the four organisms do not have a common ancestor. b) humans are more closely related to chimps than any other apes. c) chimps are more closely related to gorillas than they are to humans. eliminate d) there is no evidence if any relationship between the four branches on the tree.
Answers: 3
Biology, 22.06.2019 05:30
This class has taught you that the use of science and medicine in practical ways has become an international endeavor. one of the greatest examples of an international science accomplishment is which allows the profiling of human dna, useful not only to science but also medicine. a) forensic science b) the fbi c) the human genome project d) bioterrorism
Answers: 1
Biology, 22.06.2019 10:10
What is a photon? a. part of a ribosome b. a light particle c. a carbon dioxide molecule d. part of a chloroplast b.a light particle
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
What happened in the jurassic time period?...
Biology, 07.06.2021 18:20
English, 07.06.2021 18:20
Social Studies, 07.06.2021 18:20
Mathematics, 07.06.2021 18:20
Mathematics, 07.06.2021 18:20
Mathematics, 07.06.2021 18:20
English, 07.06.2021 18:20