DNA message #2: GAGCGCACCATCGGGAAGCTA
Transcription:
Translation:...
![subject](/tpl/images/cats/biologiya.png)
Biology, 16.12.2021 19:20 michaelgold1
DNA message #2: GAGCGCACCATCGGGAAGCTA
Transcription:
Translation:
![ansver](/tpl/images/cats/User.png)
Answers: 3
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 21.06.2019 22:00
Which of the following scenarios is an example of the bottleneck effect? answers a in south africa, much of the afrikaner population is descended from a small number of dutch colonists. in this population, this is an unusually high frequency of pseudoxanthoma elasticum (pxe), an elastic tissue disorder. b four white-tailed deer are introduced to a park in finland. thirty years after their introduction scientists compare the genes in the population and find that there is no variation. c during the industrial revolution, london's air became filled with soot. as a result, birds started eating more of the lighter moths because they were easier to spot than their darker counterparts. over time, the moth population changed so that there were more darker moths than lighter ones. d 10% of the population of american alligators in an area have the recessive trait albinism. a massive flood results in the death of 80% of the population. of the remaining population, 60% have the recessive trait of albinism.
Answers: 2
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 03:30
Based on the topographic map of mt. st. helens, what is the contour interval of the volcano about height is 2,950 m?
Answers: 2
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 08:00
Which set of terms best describes a community of miners who live out in the countryside of west virginia and use specialized geological equipment to analyze the composition of rock?
Answers: 1
You know the right answer?
Questions
![question](/tpl/images/cats/es.png)
![question](/tpl/images/cats/himiya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 11.10.2019 21:20
![question](/tpl/images/cats/ekonomika.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 11.10.2019 21:20
![question](/tpl/images/cats/mat.png)
Mathematics, 11.10.2019 21:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 11.10.2019 21:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 11.10.2019 21:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 11.10.2019 21:20
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 11.10.2019 21:20