subject
Biology, 15.12.2021 18:00 jazminpratt0311

what was the greatest impact of the national environmental policy act? a. the involvement of the president b. delegating environmental responsibility between local and national governments c. establishing water pollution control d. requiring governmental agencies to prepare environmental assessments and impact statements

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 00:10
Describe the response the kidneys have to dehydration and excessive water intake. what happens to the concentration of urine in each case ?
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 20:00
The means by which a cell transports large molecules out of the cell is called
Answers: 1
question
Biology, 22.06.2019 21:30
Kara has a plant that produces either purple or white flowers. she crosses a plant that has two recessive alleles for white flowers with a plant that has two dominant alleles for purple flowers. which result would be true of all of the offspring? a) all of the offspring would have two recessive alleles and white flowers. b) all of the offspring would have two dominant alleles and purple flowers. c) all of the offspring would have one recessive allele, one dominant allele, and white flowers. d) all of the offspring would have one recessive allele, one dominant allele, and purple flowers
Answers: 1
You know the right answer?
what was the greatest impact of the national environmental policy act? a. the involvement of the pre...
Questions
question
Mathematics, 05.10.2020 15:01
Questions on the website: 13722363