subject
Biology, 14.12.2021 22:30 Graciouzgigi1394

What is the address for Niobium (Nb)

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 04:40
Awoman whose sister tested positive for a specific mutation in the brca1 gene, which increases the risk for breast and ovarian cancer, is found not to have that mutation but does have a mutation of unknown significance near the known mutation site. how should this woman be counseled? select one: a. she should be informed that her risk for breast cancer is greater than the general population but not as great as her sister’s risk. b. she should be informed that because she does not have the mutation, her risk for breast cancer is not greater than that of the general population. c. she should be informed of her gene mutation status and be presented with all the available prophylaxis options and reconstruction options. d. she should be informed that she does not have the specific mutation but that because another mutation is present she should be vigilant about screening
Answers: 1
question
Biology, 22.06.2019 07:00
Brainliest ! which would require more force to move or slow down between a bowling ball and a soccer ball? explain why?
Answers: 1
question
Biology, 22.06.2019 10:00
Dna and rna share a number of similarities,but they also differ in certain aspects of their structure. wich nitrogenous base is found in rna but is not found in dna
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
What is the address for Niobium (Nb)...
Questions
question
Mathematics, 18.07.2019 00:30
question
Social Studies, 18.07.2019 00:30
question
Mathematics, 18.07.2019 00:30
question
English, 18.07.2019 00:30
Questions on the website: 13722363