Need help look at pdf/link part 5. a b and c
1. Use this sequence of DNA to answer the following former test questions:
5’-- TTAATGGGACAGCTTGTGTAGAGG --3’
a. What is the complementary strand of DNA?
b. Using the complementary strand of DNA (your answer from part a) as the template
strand, what is the transcribed mRNA sequence?
c. What is the amino acid sequence translated from the strand of mRNA synthesized in
part b (use the genetic code below)?
Remember:
i. Start codon!
ii. Stop codon!
Chart in pdf
Answers: 1
Biology, 21.06.2019 20:00
Johannesburg kepler, an apprentice of brahe, believed in the heliocentric universe but rejected past astronomers belief in
Answers: 2
Biology, 21.06.2019 22:00
Which excerpt from the land, part 4 best supports the claim that paul is a talented horseback rider? a/“figure that says more than anything else! now, i want to ride that stallion! " b/my daddy shook his head. "paul only rides horses he knows. ” c/? i glanced over at the other rider. the fellow was older than i, and had the weight of a man on him. d/a man out of alabama, man name of ray sutcliffe, told my daddy i was such a good rider, he wanted me to ride some races for him.
Answers: 1
Biology, 21.06.2019 23:00
Based on the data in your tables, did the light-colored moths have a higher or lower survival rate after the industrial revolution?
Answers: 2
Need help look at pdf/link part 5. a b and c
1. Use this sequence of DNA to answer the following f...
Computers and Technology, 17.03.2020 19:24
Mathematics, 17.03.2020 19:24
Chemistry, 17.03.2020 19:24
Mathematics, 17.03.2020 19:25
Biology, 17.03.2020 19:25
Biology, 17.03.2020 19:25
Computers and Technology, 17.03.2020 19:25