The graph below shows the approximate average annual ocean heat content from 1993 to 2020. It was created using data from NOAA. Line 1 represents ocean levels from the surface to 2,300 feet below ocean surface. Line 2 represents ocean levels from 2,300 feet to 6,560 feet below ocean surface. Which statement describes the approximate average trend of ocean heat content between 2,300 and 6,560 feet under the ocean during this time period?

- An increase of about 130 x 1021 joules
- An increase of about 80 x 1021 joules
- A decrease of about 20 x 1021 joules
- A decrease of about 80 x 1021 joules

Liquid water turns into water vapor at which step in the water cycle

The accompanying figure shows the percent of selected dna sequences that match between a chimpanzee and other primates. these data support the hypothesis that the figure shows the percentage of selected d n a sequences that match between the chimpanzee and other primates. the human has an almost 98 percent match, the gorilla has an almost 97 percent match, the orangutan has a 96 percent match, the gibbon has an almost 95 percent match, and the old world monkey has an almost 92 percent match. the accompanying figure shows the percent of selected dna sequences that match between a chimpanzee and other primates. these data support the hypothesis that the figure shows the percentage of selected d n a sequences that match between the chimpanzee and other primates. the human has an almost 98 percent match, the gorilla has an almost 97 percent match, the orangutan has a 96 percent match, the gibbon has an almost 95 percent match, and the old world monkey has an almost 92 percent match. chimpanzees and gibbons are the most closely related the chimpanzee's closest surviving relative is humans orangutans are the primates least closely related to chimpanzees old world monkeys and gibbons are the most closely related

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?