![subject](/tpl/images/cats/biologiya.png)
Biology, 01.10.2021 16:00 gamboaserg
Earth is heated by radiation, conduction, and convection. Which of these is most responsible for the heating of the earth?
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 06:30
Areal dna molecule consists of thousands of these pairs of nucleotides. what is the pairing arrangement of the nitrogen bases
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 07:50
One function of the poly-a tail on eukaryotic mrna sequences is to the mrna be transported from the nucleus to the cytoplasm. prokaryotic mrna also has a poly-a tail. choose the best explanation of the prokaryotic poly-a tail. a. prokaryotic poly-a tails are composed of a different molecular structure compared with eukaryotic poly-a tails. b. prokaryotic poly-a tails have the same functions as eukaryotic poly-a tails, because this process is highly conserved throughout different species. c. prokaryotic poly-a tails aren't important, because prokaryotes don't have nuclei. d. prokaryotic poly-a tails have other functions,because prokaryotes don't have nuclei.
Answers: 3
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 15:30
On his trip to the galapagos islands, darwin determined that animals on the islands
Answers: 1
You know the right answer?
Earth is heated by radiation, conduction, and convection. Which of
these is most responsible for t...
Questions
![question](/tpl/images/cats/mat.png)
Mathematics, 23.09.2019 20:40
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/himiya.png)
Chemistry, 23.09.2019 20:40
![question](/tpl/images/cats/health.png)
Health, 23.09.2019 20:40
![question](/tpl/images/cats/istoriya.png)
History, 23.09.2019 20:40
![question](/tpl/images/cats/mat.png)
Mathematics, 23.09.2019 20:40
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/istoriya.png)
History, 23.09.2019 20:40
![question](/tpl/images/cats/mat.png)
Mathematics, 23.09.2019 20:40
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 23.09.2019 20:40
![question](/tpl/images/cats/mat.png)
Mathematics, 23.09.2019 20:40
![question](/tpl/images/cats/mat.png)
Mathematics, 23.09.2019 20:40
![question](/tpl/images/cats/mat.png)
Mathematics, 23.09.2019 20:40
![question](/tpl/images/cats/istoriya.png)
History, 23.09.2019 20:40
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/obshestvoznanie.png)
Social Studies, 23.09.2019 20:40
![question](/tpl/images/cats/mat.png)