subject
Biology, 08.09.2021 01:40 emely1139

Number of hydrogen atoms: Number of oxygen atoms:
Type of bonds
Shape of molecule
Made of which ions:


Number of hydrogen atoms:

Number of oxygen atoms:
Type of bonds
Shape of molecule
Made of which i

ansver
Answers: 3

Another question on Biology

question
Biology, 22.06.2019 04:40
The cluster of developing cells from conception until birth is called an
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:30
The table below shows data for a population of fish in a pond. fish body color # of fins scales? tail shape a silver 4 yes fan b pink 4 yes flat c black 4 yes fan d orange 4 yes flat e orange 4 yes fan f silver 4 yes flat which of the above characteristics would be most in developing a classification system for the fish? a. body color and tail shape b. presence of scales and tail shape c. body color and number of fins d. number of fins and presence of scales
Answers: 2
question
Biology, 22.06.2019 15:00
Pls me i need this ! each cell has genes activated depending on it's job and what kind of cell it is. it is the presence of that causes the repressor protein to fall off and unblock the gene on the lac operon. if a gene is turned on then it is being an additional circular chromosome found in some bacteria that is used in genetic engineering.
Answers: 2
You know the right answer?
Number of hydrogen atoms: Number of oxygen atoms:
Type of bonds
Shape of molecule
Questions
question
Business, 17.10.2019 15:50
question
Social Studies, 17.10.2019 15:50
question
Mathematics, 17.10.2019 15:50
Questions on the website: 13722367