subject
Biology, 02.09.2021 20:00 asims44

How can the smallest unit of matter (the atom) contribute to the structure of living things?

ansver
Answers: 2

Another question on Biology

question
Biology, 22.06.2019 10:00
The structure that houses the cells genetic information.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 15:00
Agroup of students want to live a healthier life style they decide to use one of these following vegetable oils for cooking apex
Answers: 1
question
Biology, 22.06.2019 15:40
Which kind of mutation has occurred when the codon for an amino acid is changed to a stop codon? a. a silent mutation b. a missense mutation c. a frameshift mutation d. a nonsense mutation
Answers: 1
You know the right answer?
How can the smallest unit of matter (the atom) contribute to the structure of living things?...
Questions
question
Mathematics, 22.04.2020 01:32
question
English, 22.04.2020 01:32
Questions on the website: 13722366